Labshake search
Citations for Millipore Sigma :
251 - 300 of 10000+ citations for 5 tert Butyl 3 isocyanatoisoxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Zoology 2024Quote: ... and N-methyl-N-(tert butyldimethylsilyl) trifluoroacetamide (MTBSTFA) were purchased from Sigma-Aldrich (Supelco, 98.5%).
-
bioRxiv - Cell Biology 2024Quote: ... cells treated with 1 mM Tert-butylhydroperoxide (Luperox TBHP solution, 458139 lot#BCBG4467V Sigma Aldrich) for 2 h were used ...
-
bioRxiv - Developmental Biology 2020Quote: ... and N-[N-(3,5-difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT D5942, 1μM, Sigma-Aldrich).
-
bioRxiv - Synthetic Biology 2022Quote: ... the middle phase was supplemented with 15 % porogen butyl acetate or 1-decanol (both from Sigma-Aldrich), 1 % Span80 (Fluka ...
-
bioRxiv - Bioengineering 2023Quote: ... gels were washed 3 times x 5 minutes with a 3% Bovine Serum Albumin (BSA, Sigma) blocking solution in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... Bottom coverslips are activated with a 2% 3-Aminopropyltrimethoxysilane (3-APTMS) (Sigma Aldrich 13822-56-5) in 96% ethanol solution for 5 minutes and washed with 70% ethanol ...
-
bioRxiv - Molecular Biology 2024Quote: ... or SC-Leu-Trp-His +5 mM 3-AT (3-Amino-1,2,4-triazole, Sigma, 18056-25G). Plates were incubated at 30°C and imaged daily for at least three days.
-
bioRxiv - Animal Behavior and Cognition 2024Quote: The 5-HT2C antagonist 6-Chloro-2,3-dihydro-5-methyl-N-[6-[(2-methyl-3-pyridinyl)oxy]-3-pyridinyl]-1H-indole-1-carboxamide dihydrochloride (SB242084; Sigma Aldrich) at a dose of 1.0 mg/kg.
-
bioRxiv - Plant Biology 2020Quote: ... 150 µM 3′,5′-Dimethoxy-4′-hydroxyacetophenone (acetosyringone; SIGMA, USA) at a 23.7×108 cfu/ml (OD600=0.75 ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 × 5 minutes each and were mounted using Fluorosave (Millipore) before imaging ...
-
bioRxiv - Immunology 2021Quote: ... siRNA-TDP-43 D: 5’-GAAACAAUCAAGGUAGUAA[dT][dT]-3’ (Sigma)4 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 100 µM acetosyringone (3′,5′-dimethoxy-4′-hydroxyacetophenone, Sigma D134406), and incubated for 6h at 28°C at 150 rpm.
-
bioRxiv - Microbiology 2021Quote: ... 5 × 10−3 g/L human insulin (Sigma Aldrich, USA), 5 × 10−5 M hydrocortisone (Upjohn Laboratories SERB ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse Primer 5’-TGGTTGAGCACAGGGTACTT-3’] were synthesized by Sigma-Aldrich, USA ...
-
bioRxiv - Plant Biology 2020Quote: ... 200 μM 3′,5′-Dimethoxy-4′-hydroxyacetophenone (acetosyringone) (SIGMA, USA) carrying the corresponding binary plasmids (Table 1) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgCl2 and phosphatase (phosphatase inhibitor cocktail 3, Sigma) and protease inhibitors (EDTA free cOmplete™ protease inhibitors ...
-
bioRxiv - Biochemistry 2021Quote: ... 5-Bromo-4-Chloro-3-Indolyl-phosphate (BCIP, Sigma B8503) was used as the chromogenic substrate.
-
bioRxiv - Cell Biology 2021Quote: ... (3) TGFβ2 (5 ng/ml) + GsMTx4 (500 nM; Sigma-Aldrich), or (4 ...
-
bioRxiv - Physiology 2022Quote: ... 3 nM 3,3’,5-Triiodo-L-thyronine sodium salt (Sigma), 10 ng/ml EGF (Sigma) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membranes were blocked in 3-5% skimmed milk (Sigma) dissolved in Tris buffered saline + 0.2% v/v Tween-20 (TBST) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2’-O-dibutyryladenosine 3:5-cyclic monophosphate (dbcAMP; Sigma-Aldrich), and 0.1 mM 3-isobutyl-1-methyl xanthine (IBMX ...
-
bioRxiv - Cell Biology 2023Quote: ... 5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside (Sigma) was used at a final concentration of 1mg/ml ...
-
bioRxiv - Plant Biology 2023Quote: ... and BCIP (5-bromo-4-chloro-3-indolyl-phosphate; Sigma).
-
bioRxiv - Immunology 2024Quote: ... reverse primer (5’-3’): GACGGTGCCATGGAATTTGC) and purchased from Sigma-Aldrich. RT-qPCR was performed with gene-targeted primers using TB Green Premix Ex Taq II (Tli RNase H Plus ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 mM 3-indol-acetic acid (IAA; Sigma-Aldrich, I2886) was added 1 h prior to adding phleomycin or β-estradiol.
-
bioRxiv - Cancer Biology 2024Quote: ... cells were exposed to 3-Methyladenine (5 mM; Sigma, M9281) for 24 hours ...
-
bioRxiv - Microbiology 2023Quote: The small interfering RNAs (siRNAs) against NLRP3 (siNLRP3) (5’-UGCAAGAUCUCUCAGCAAA-3’) and the corresponding control siRNAs (siControl) (5’-UUCAAUAAAUUCUUGAGGU-5’) were synthesized from Sigma. The siGenome smart pool siRNAs and siON Target plus siRNAs were purchased from Dharmacon and are composed of a pool of four siRNAs ...
-
bioRxiv - Physiology 2023Quote: ... glycogen phosphorylase was inhibited by IV (jugular vein) injection of 1-(3-(3-(2-Chloro-4,5-difluorobenzoyl)ureido)-4-methoxyphenyl)-3-methylurea (Sigma, 5 mg/kg) one hour prior to the start of a tracer infusion ...
-
bioRxiv - Immunology 2020Quote: ... and product intensity measured by Software ImageJ(83) and normalized to ACTIN amplicon products (5’-GACGACATGGAGAAAATCTG-3’ and 5’-ATGATCTGGGTCATCTTCTC-3’, Sigma-Aldrich, St. Louis, Missouri, USA).
-
bioRxiv - Neuroscience 2020Quote: ... were performed with MTT (3-(4, 5-dimethylthiazol-2-yl)-2-5-diphenyltetrazolium bromide) (Sigma-Aldrich) as described in Sanz et al ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3 mM N6,2′-O-Dibutyryladenosine 3′,5′-cyclic monophosphate sodium salt (cAMP, #D0260, Sigma-Aldrich, USA). Electro medium consists of 1:1 DMEM/F-12 (#31331028 ...
-
bioRxiv - Microbiology 2024Quote: ... and Tuba (5’-CAGAATCATGATGAGGCCAtt-3’. These siRNAs were obtained from Sigma-Aldrich (Dyn2-2 and Dyn2-3) or Qiagen (Tuba ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were spiked with deuterated 17 beta-estradiol and then extracted with n-butyl chloride (Sigma-Aldrich, Inc). The organic layer was dried under nitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... All N/Tert-1 cells were also supplemented with 4 μg/ml hygromycin B (Millipore Sigma). All cells not directly purchased from providers were cell type confirmed by Johns Hopkins or MD Anderson cell line authentication services ...
-
bioRxiv - Bioengineering 2020Quote: ... borane-tert-butylamine complex ((CH3)3CNH2 · BH3) and lithium bromide (LiBr) were purchased from Sigma Aldrich. Hydrogen tetrachloroaurate(III ...
-
bioRxiv - Cell Biology 2020Quote: ... The surfaces were then incubated with 5% (3-Aminopropyl)trimethoxysilane (Sigma) in ethanol for 5 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate (Sigma-Aldrich, 136149) in [0.1 M Tris-HCl ...
-
bioRxiv - Developmental Biology 2020Quote: ... CHIR99021 (3 μM) and LY411575 (5 μM, Sigma-Aldrich, no. SML0506). Culture media was changed every other day.
-
bioRxiv - Neuroscience 2021Quote: ... as control siRNA for luciferase was used (5’-UAAGGCUAUGAAGAGAUAC-3’; Sigma). Immediately before transfection 2×106 cells were seeded in 6-well plates in 1.4 ml of medium containing 10% fetal serum ...
-
bioRxiv - Bioengineering 2021Quote: ... 5□μL 3-aminopropyltriethoxysilane (APTES) 99% (Sigma-Aldrich cat. no. 440140) was added ...
-
bioRxiv - Bioengineering 2022Quote: ... The PDMS parts were submerged in a 5% 3-aminopropyltriethoxysilane (Sigma) solution to generate surface amine ...
-
bioRxiv - Neuroscience 2021Quote: ... reversely transfected (human siTDP 5’-GCAAAGCCAAGAUGAGCCU-3’, Sigma-Aldrich or siLUC) and harvested 48 h later ...
-
bioRxiv - Microbiology 2022Quote: ... Pectinase activity by the 3’,5’-dinitrosalicylic acid (DNS) (Sigma-Aldrich) method (Miller ...
-
bioRxiv - Molecular Biology 2022Quote: ... (5’-CACGGGACAGCCTGAGCGGAACGGTGCTAATCGTGCGGT-3’) strand of e5 probe were synthesized (Sigma-Aldrich) and sense strand was end labelled with [γ32P] ATP using T4 polynucleotide kinase according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... 40 nM of siTDP (mouse siTDP 5’-CGAUGAACCCAUUGAAAUA-3’, Sigma-Aldrich) or non-targeting siLUC (5’-UAAGGCUAUGAAGAGAUAC-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate (Sigma Ref. 10760994001). The control DMRT5 transcript was prepared as previously described [50].
-
bioRxiv - Microbiology 2022Quote: ... 3-Methyl-1-phenyl-2- pyrazolin-5-one (Edaravone; Millipore 443300) was resuspended in ethanol at 500mM and heated at 65°C for solubilization ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.1 mM 8-Bromoadenosine 3′,5′-cyclic monophosphate sodium salt (Sigma), and 0.1 mM IBMX (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... CHIR99021 (3 μM) and LY411575 (5 μM, Sigma-Aldrich, no. SML0506)].
-
bioRxiv - Microbiology 2023Quote: ... 2’,3’,5’-Triacetyl-6-azauridine (azaribine; Sigma-Aldrich, Cat. # T340057), and brequinar sodium salt hydrate (brequinar ...