Labshake search
Citations for Millipore Sigma :
501 - 550 of 10000+ citations for 5 tert Butyl 3 isocyanatoisoxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Neuroscience 2024Quote: ... Slices were subsequently washed 3 x 5 minutes in PBST 0.01% (DPBS ThermoFisher, Tween P1379 Sigma), permeabilised for 15 minutes in PBST 0.5% and washed in PBST 0.01% a further three times ...
-
bioRxiv - Physiology 2024Quote: ... Samples were washed (3 times, 5 min each) with PBS containing 0.1% Triton X100 (Sigma-Aldrich), and then incubated with secondary antibody (Table 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... human Spindly siRNA (Sequence antisense: 5’-GAAAGGGUCUCAAACUGAA-3’, dTdT overhangs, Sigma-Aldrich, St. Louis, MO, USA), and control siRNA (D-001810-10-05 ...
-
bioRxiv - Physiology 2024Quote: ... tissues were washed (3 x 5 min) in PBS containing 0.1% Triton X-100 (Sigma-Aldrich) and incubated with mouse anti-TARDBP primary antibody or mouse anti-HuC/D (for total neurons ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3-(4,5-dimethylthiazolyl-2-yl)-2–5 diphenyl tetrazolium bromide (MTT, Sigma, St. Louis, Missouri, USA) was introduced ...
-
bioRxiv - Cell Biology 2024Quote: ... The control siRNA is a scrambled sequence (5’-UUCUCCGAACGUGUCACGUdTdT-3’) (NC, Sigma, St. Louis, MO, USA). A total of 60 nM siRNAs was used for transfection using Lipofectamine-RNAi-MAX Reagent (13778 ...
-
bioRxiv - Bioengineering 2024Quote: ... KG) followed by incubation in freshly made 5% (3-Aminopropyl) triethoxysilane (Sigma-Aldrich, Cat. no. 440140) in deionized water for 20 minutes ...
-
bioRxiv - Developmental Biology 2024Quote: ... Staining was detected with 5-bromo-4-chloro-3’-indolylphosphate/nitro-blue-tetrazolium (BCIP/NBT, Sigma).
-
bioRxiv - Plant Biology 2023Quote: ... the samples were trimmed down to a 3-5 mm region around the area of interest and embedded in 5% (w/v) agarose (A9539; Sigma-Aldrich, St. Louis, MO, USA) in deionized water ...
-
bioRxiv - Neuroscience 2023Quote: ... minced using sterile razor blades and digested in a 5 mL tube containing 3-5 mL of the digestion mix at 37 °C for 90 minutes: Collagenase type V (Sigma-Aldrich C9263; 5 mg/mL) and Dispase II (Gibco 17105041 ...
-
bioRxiv - Microbiology 2020Quote: ... samples were incubated with 3% acetic acid for 5 min and followed by Alcian blue (Sigma, B8438) (in 3% acetic acid ...
-
bioRxiv - Molecular Biology 2020Quote: ... per sample were washed 3 times with PBS/BSA (PBS with 5 mg/ml BSA (Sigma Aldrich)) ...
-
bioRxiv - Biochemistry 2021Quote: ... Adenosine 3′-phosphate 5′-phosphosulfate lithium salt hydrate (PAPS) and the antibiotics were purchased from Sigma-Aldrich Co ...
-
bioRxiv - Immunology 2021Quote: Lentivirus based knockdown of human ATG16L1 (5’-ACTGTAGCTTTGCCGTGAATG-3’) was performed using MISSION shRNA constructs (Sigma-Aldrich) and psPAX2 packaging system ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μM medroxyprogesterone acetate and 500 μM N6,2’-O-dibutyryladenosine 3’:5’-cyclic monophosphate (Sigma Cat # D0627); hereafter ...
-
bioRxiv - Neuroscience 2022Quote: ... and ≥99% 4-methyl-3-heptanol and 99% 6-methyl-5-hepten-2-one from Sigma-Aldrich (Item numbers M48309 and M48805-100ML ...
-
bioRxiv - Neuroscience 2023Quote: ... washed with PBST (0.1% Triton X-100 in 1X PBS; 3 x 5 minutes; Sigma-Aldrich, X100), and incubated with Click-iT Plus EdU reaction cocktail (Alexa Fluor 555 ...
-
bioRxiv - Physiology 2022Quote: ... we tested for leak of FITC-dextran (FD4; 3–5 kDa, Sigma-Aldrich, St Louis, MO, USA) from isolated gut segments of L ...
-
bioRxiv - Microbiology 2023Quote: ... mice (n=5 mice for each line) were orally administered with IAA (3-indoleacetic acid, auxin, Sigma) and by an intraperitoneal injection on a daily basis (Brown and Sibley ...
-
bioRxiv - Cell Biology 2024Quote: ... medroxyprogesterone acetate (Selleck S2567) and N6,2′-O-dibutyryladenosine 3′,5′-cyclic monophosphate sodium salt (cAMP) (Sigma D0627) for 6 days.
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of 4 mM 5-bromo-4-chloro-3-indolyl α-D-N-acetylneuraminic acid (Sigma) was added ...
-
Developmentally regulated generation of a systemic signal for long-lasting defence priming in tomatobioRxiv - Plant Biology 2023Quote: ... 1/3 of plants were soil drenched with 5 mM BABA (catalogue number A4420-7, Sigma Aldrich) to provide a final concentration of 0.5 mM in the soil ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-dione (CNQX) and 50 mM D,L-2-amino-5-phosphonovaleric acid (APV) acquired from Sigma to suppress post-synaptic responses ...
-
bioRxiv - Microbiology 2023Quote: ... the reverse primer CCR5del2 (5’-CATGATGGTGAAGATAAGCCTCACA-3’) was common for both (all Sigma-Aldrich; St. Louis, MO). Two PCR master mixes differing only in the forward primer were prepared at a final volume of 10 µL ...
-
bioRxiv - Biophysics 2023Quote: ... dried before covering the surface with 3-aminopropyltriethoxysilane (APES) at room temperature for 5 min (Sigma-Aldrich) and rinsed with distilled water ...
-
bioRxiv - Microbiology 2023Quote: ... 5 µL of an overnight culture was spotted onto BHI agar plates supplemented with 3% gelatin (Sigma). Plates were incubated at 37 °C overnight and then at 4 °C to enable better visualization of the gelatinase-positive phenotype ...
-
bioRxiv - Developmental Biology 2024Quote: Zebrafish larvae at 3 and 5 dpf were incubated in 2.5 ug/mL Neutral Red (Sigma-Aldrich) dissolved in E3 containing 0.003% (m/v ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5’-TAATACGACTCACTAT AGGGT-3’ were generated with end-point PCRs using FastStart Taq Polymerase (#4738357001, Sigma Aldrich) and purified using the ChargeSwitch™ PCR Clean-Up Kit (#CS12000 ...
-
bioRxiv - Neuroscience 2024Quote: ... Miltenyi Biotech) and N6,2’-O-Dibutyryladenosine 3’,5’-cycle monophosphate sodium salt [db-cAMP (0.5 mM, Sigma)] were added ...
-
bioRxiv - Neuroscience 2024Quote: ... 8-cyclopentyl-1,3-dimethylxanthine (CPT; 3 nmol in 5 μl saline of 2% DMSO; #C102; Sigma-Aldrich; injection was given immediately before the start of exposure to restraint stress or 30 min before intrathecal injection of NA).
-
bioRxiv - Systems Biology 2024Quote: ... n = 3-5 per sex per genotype) were dissected and pooled in HBSS (Sigma, Cat. No. H9394) with heparin (Sigma ...
-
bioRxiv - Biophysics 2024Quote: ... 3% Mouse on Mouse blocking reagent (Bio-Techne, USA) and 5% Normal Donkey Serum (Sigma-Aldrich, Germany)) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5-10 mg dry sample was dissolved in 600 μl D2O (99.9%) and added 5 μl 3-(Trimethylsilyl) propionic 2,2,3,3-d4 acid (TSP, Sigma Aldrich) as an internal standard ...
-
bioRxiv - Neuroscience 2022Quote: ... After anesthesia with 0.5 g/kg avertin (1.875% solution dissolved in 0.9% sodium chloride pre-warmed at 37°C, 2,2,2-tribromoethanol; Sigma Aldrich #T48402; 1mg/ml in tert-amyl alcohol), injected intra-peritoneally (i.p.) ...
-
bioRxiv - Cell Biology 2021Quote: ... washed 3 times in 1X PBS and incubated for 5 min in 50mM ammonium chloride (Sigma-Aldrich, 254134) before mounting on cavity blades (Marienfeld ...
-
bioRxiv - Cell Biology 2021Quote: ... TACC3 (5’ GAGCGGACCUGUAAAACUA 3’) and a non-targeting oligo against Luciferase was used as control (Sigma, Custom order). RNAi Max (Invitrogen ...
-
bioRxiv - Bioengineering 2021Quote: Before staining with either 5-bromo-4-chloro-3′-indolyphosphate and nitro-blue tetrazolium (BCIP/NBT, Sigma-Aldrich) for alkaline phosphatase (ALP ...
-
bioRxiv - Neuroscience 2020Quote: ... thiolated ssDNA oligonucleotide (5’ Thiol-C6-AAT ATC GCG GAC AGA AGA CG 3’) was obtained from Sigma. This sequence was derived from a plasmid of Neisseria gonorrhoeae (pCmGFP ...
-
bioRxiv - Microbiology 2021Quote: ... and the sequences of the siRNAs targeting DDX42 were siDDX42-1: 5’-CAGAAUGCCUGGUUUCGGA-3’ (SASI_Hs01_00119846, Sigma-Aldrich®), siDDX42-2 ...
-
bioRxiv - Biophysics 2020Quote: ... a mica surface was treated for 5 min with 0.01% (v/v) (3-aminopropyl)triethoxysilane (APTES) (Sigma-Aldrich). HS-AFM observations of the 50S subunits from Pyrococcus furiosus or pre-assembled hybrid 50S subunits were performed as follows ...
-
bioRxiv - Plant Biology 2021Quote: ... The full length coding sequence of AdACS1/2/3 and AdACO3/5 were inserted into pET-32a (Novagen) vector and then transferred into Escherichia coli strain BL21 (DE3) ...
-
bioRxiv - Genomics 2021Quote: ... Cross-linked chromatin was immunoprecipitated with either 5 μg anti-TCF4/TCF7L2 (Clone 6H5-3, #05-511, Millipore) or normal mouse control IgG (#12-371 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and color was developed with 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT; Sigma). Following color development ...
-
bioRxiv - Bioengineering 2022Quote: For HP-β-CD-treatment 3×SNCA hMOs were exposed to 5 μM HP-β-CD (Sigma Aldrich) in cell culture media starting from D10 of differentiation.
-
bioRxiv - Cancer Biology 2022Quote: ... following additional 5 min incubation with 100 nM Anionic Oxonol Dye DiBAC4(3) (D8189, Sigma Aldrich, MO, USA). Fluorescence was analysed on a BD FACSCalibur flow cytometer ...
-
bioRxiv - Immunology 2022Quote: ... To asses mitochondrial fuel usage OCR was measured subsequent to the addition of the following drugs in different combinations as indicated: 3 μM bis-2-(5-phenylacetamido-1,3,4-thiadiazol-2-yl)ethyl sulfide (BPTES) (SML0601, Sigma), 2 μM UK-5099 (PZ0160 ...
-
bioRxiv - Neuroscience 2022Quote: ... we delivered the Iκ-kinase inhibitor [5-(p-Fluorophenyl)-2-ureido]thiophene-3-carboxamide (TPCA-1; Sigma-Aldrich CAS 507475-17-4 ...