Labshake search
Citations for Millipore Sigma :
451 - 500 of 10000+ citations for 5 tert Butyl 3 isocyanatoisoxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... 4 μM α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA, No.A6816, Sigma-Aldrich) was initially added in HBSS buffer to enhance baseline Ca2+ signals ...
-
bioRxiv - Developmental Biology 2022Quote: ... inflorescences from 3-week-old plants were treated with 5 μM 6-BA (Sigma-Aldrich), 50 μM IAA (Sigma-Aldrich) ...
-
The cellular basis of protease activated receptor type 2 (PAR2) evoked mechanical and affective painbioRxiv - Neuroscience 2020Quote: ... and 3 ug/ml 5-fluoro-2’-deoxyuridine + 7 ug/ml uridine (FRD+U; Sigma) added ...
-
bioRxiv - Genomics 2020Quote: ... into 384 well plates containing 3 μl of Smart-seq3 lysis buffer (5% PEG (Sigma), 0.10% Triton X-100 (Sigma) ...
-
bioRxiv - Physiology 2020Quote: ... and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP; Sigma-Aldrich, Gillingham, UK) substrate solution (50 mg/ml BCIP in autoclaved water ...
-
bioRxiv - Neuroscience 2021Quote: ... A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’) was synthesized by Sigma Aldrich. The gRNA ...
-
bioRxiv - Cell Biology 2021Quote: ... Sig8-bromoadenosine 3′,5′-cyclic monophosphate sodium salt (8-Br-cAMP, Sigma-Aldrich, Darmstadt, Germany) at 0 hpi to a final concentration of 0.2 mM ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3 μg/mL + 7 μg/mL FRD+U (5-Fluoro-2′-deoxyuridine, Sigma-Aldrich, Cat# F0503 and Uridine ...
-
bioRxiv - Physiology 2023Quote: ... The non-targeting shRNA sequence used as negative control was 5’-CAACAAGATGAAGAGCACCAA-3’ (Sigma-Aldrich). Lentivirus was collected beginning 48-hrs post-transfection and concentrated with Lenti-X Concentrator (Takara Bio USA ...
-
bioRxiv - Cell Biology 2023Quote: ... washed 3 times for 5 min in PBS and permeabilized with 0.5% NP-40 (Sigma) in PBS for 5 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The following siRNAs were used in this study: siMis12C (Dharmacon siMIS12 5’-GACGUUGACUUUCUUUGAU-3’; Sigma siDSN1 5’-GUCUAUCAGUGUCGAUUUA-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1% Tween (Fisher)] containing either 5% non-fat milk powder or 3% BSA (Sigma-Aldrich) at room temperature for 40 minutes ...
-
bioRxiv - Microbiology 2024Quote: Sulfamethoxazole (IUPAC: 4-Amino-N-(5-methylisoxazol-3-yl)-benzenesulfonamide) was purchased from Sigma-Aldrich, USA ...
-
bioRxiv - Neuroscience 2024Quote: ... 2’-O-Dibutyryladenosine 3’,5’-cyclic monophosphate sodium salt (cAMP; 50 μM, Millipore Sigma, D0627), and cis-4 ...
-
bioRxiv - Cell Biology 2024Quote: ... 3-5 kDa fluorescein isothiocyanate– dextran (FITC-dextran; 500 µg/ml, Sigma-Aldrich #FD4-100MG) was added to the culture media in the top channel ...
-
bioRxiv - Biophysics 2024Quote: ... were activated for 5 min with a solution of 3-(Trimethoxysilyl)propyl methacrylate (Sigma-Aldrich, 440159 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 500 µg/ml N6,2’-O-Dibutyryladenosine 3’,5’-cyclic monophosphate sodium salt (dbcAMP, Sigma). Cells were used for experiments up to passage 8 ...
-
bioRxiv - Biochemistry 2021Quote: ... All standard amino acids were purchased from AAPPTec except for: N-α-Fmoc-O-t-butyl-L-trans-4-hydroxyproline (Hyp) was purchased from EMD Millipore (Billerica, MA), Fmoc-γ-carboxy-glutamic acid γ,γ-di-t-butyl ester (Gla ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2-4 months old mice were orally gavaged with 3 x 2 (Mist1creERT/+KRASG12D/+) or 5 x 5 mg (Ptf1acreERT/+KRASG12D/+) of tamoxifen (TX; Sigma-Aldrich, T5648-5G) at Western University and 5 x 4 mg (Ela-creERT ...
-
bioRxiv - Biochemistry 2020Quote: ... The reactants were dissolved in 25 mL of a solvent mixture consisted of 80% DMSO and 20% tert-amyl alcohol (Sigma Aldrich Co.) in which 1 g of 3 Å molecular sieves was added and the mixture was sonicated for 20 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were then incubated for 1 hour at 60°C following the addition of 20ul of tert-Butyldimethylsilyl (tBDMs) (Sigma, Cat# 394882). Derivatized samples were analyzed with an 8890 gas chromatograph with an HP-5MS column (Agilent ...
-
bioRxiv - Neuroscience 2021Quote: ... FW 5’ – CCA CAT GGG AGA GTC ACA T −3’ and RV 5’-ATA GCC TGG AAG CGG TCA GAT G −3’ (Sigma-Aldrich Japan, Inc., Tokyo, Japan). The PCR products (521 bp ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then dehydrated in ascending concentrations of ethanol for 5 min each (2[×[35%, 50%, 70%, 80%, 90%, 3[×[100%) and washed 3 times for 5 min with propylene oxide (Sigma-Aldrich, #cat 110205-18L-C). Next ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were dehydrated in increasing concentrations of ethanol for 5 min each (2 × 35%, 50%, 70%, 80%, 90%, 3 × 100%) and washed 3 x 5 min with propylene oxide (Sigma- Aldrich, #cat 110205-18L-C). Sections were next embedded overnight at RT in Durcupan resin (20g component A ...
-
bioRxiv - Cell Biology 2020Quote: ... washed 3 × 5 mins in phosphate-buffered saline (PBS) with 0.1% Tween-20 (both Sigma-Aldrich) and probed for 1 hour at room temperature in the dark with IRDye® 800CW conjugated goat anti-mouse secondary antibodies (LiCOR Biosciences) ...
-
bioRxiv - Cell Biology 2020Quote: ... shLmnA (produced in our lab), shLMNC (produced in our lab, 5′-TCTCCCACCTCCATGCCAAAG-3’) or shLMNB1 (Sigma clone NM_010721.1-956s1c1 ...
-
bioRxiv - Cell Biology 2020Quote: ... washed and developed with chromogenic 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, Sigma-Aldrich, B6149).
-
bioRxiv - Physiology 2020Quote: ... and T3 (3,3’,5-triiodo-L-thyronine, > 95% HPCL, CAS number 6893-02-3, Sigma-Aldrich) were first dissolved in 0.1M NaOH and then diluted in 0.9% NaCl ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 3-5 μL of biliverdin hydrochloride (chromophore for iRFP signal activation, final concentration 0.002%, Sigma; 30891) added to cells and incubated for 10 mins at 37 °C before imaging ...
-
bioRxiv - Microbiology 2020Quote: ... 1 mg ml-1 of 3–5 kDa fluorescein isothio-cyanate (FITC)-dextran (Sigma-Aldrich, Germany) in phenol-red free DMEM/F12 medium (Sigma-Aldrich ...
-
bioRxiv - Plant Biology 2021Quote: ... Blots were developed using nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Sigma Argentina).
-
bioRxiv - Neuroscience 2020Quote: ... Then washed for 5 min x 3 times and blocked in 1% BSA (A3059, Sigma-Aldrich) (w/v ...
-
bioRxiv - Bioengineering 2022Quote: ... Sections were washed 3×5 minutes in TBST buffer and incubated with ChAT antibody (Sigma, AB144) at 1:100 dilutions overnight at 4°C in the blocking buffer ...
-
bioRxiv - Developmental Biology 2022Quote: ... cells were allowed to differentiate for 5 days with differentiating media [3 μg/ml prolactin (Sigma, #L6520 ...
-
bioRxiv - Cell Biology 2022Quote: ... The reagents treated for some indicated experiments include: 3-5 µM oligomycin A (Sigma, Cat# 75351), 1 µM (for HeLa cells ...
-
bioRxiv - Neuroscience 2021Quote: ... 300 μM of the PKA activator 8-Bromoadenosine 3’,5’-cyclic monophosphate (Sigma, dissolved in water) and without FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AGTTTCTCTGTCCGATTTAAA-3’] are in the plasmid backbone pLKO.1-CMV-tGFP and were from Sigma Millipore (St Louis ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were washed with PBS 3 times and blocked with 5% normal donkey serum (Sigma-Aldrich) in wash buffer for 1 h at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... The purified protein 5-HT2C or HCA2 (3 μg) was immobilized on nickel agarose beads (Sigma) in the incubation buffer containing 50 mM HEPES ...
-
bioRxiv - Neuroscience 2020Quote: ... and guanosine-5’-γ-3-thiotriphosphate (GTPγS) were acquired from Sigma-Aldrich (St. Louis, MO, USA). WIN 55,212-2 was purchased from Tocris Bioscience (Bristol ...
-
bioRxiv - Developmental Biology 2020Quote: ... cells were infected with pLKO.1 control or pLKO.1-shZSCAN4 (5’-GAATGCAACAACTCTTGTAATCTCGAGATTACAAGAGTTGTTGCATTCT-3’, Millipore Sigma) and further selected with Puromycin (1ug/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... and Mannitol (3 g of Bacto Peptone [Becton Dickinson], 5 g of Yeast Extract [Sigma-Aldrich] ...
-
bioRxiv - Bioengineering 2023Quote: ... All reaction mixtures contained 250 nM of sirtuin (SIRT1-3, 5 Reaction Biology, SIRT4,6,7 Sigma-Aldrich), 10 µM furimazine (Promega) ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Microbiology 2024Quote: ... Parasites were maintained at <3% parasitemia and routinely synchronized by treating with 5% sorbitol solution (Sigma) for ring stage and by using percoll gradient (Cytiva ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg/mL 5-fluoro-2′-deoxyuridine + 7 μg/mL uridine (FRDU, F0503, Sigma-Aldrich). Cultured cells were then kept at 37°C and 5% CO2 in an incubator with culture media changes at 48 hours with supplemented media and NGF and FRDU until further experimentation.
-
bioRxiv - Cell Biology 2024Quote: ... The proteins were eluted in buffer 5 [buffer 3 plus 200 μM FLAG peptide (Sigma-Aldrich)] for 1.25 hours ...
-
bioRxiv - Systems Biology 2024Quote: ... 8-Br cAMP (8-Bromoadenosine 3′,5′-cyclic monophosphate, final conc. 500 µM; Sigma B6386-100mg). In addition to stimulation for decidualization ...
-
bioRxiv - Microbiology 2024Quote: ... 3-(2pyridyl)-5,6-bis(2-(5-furylsulfonic acid))-1,2,4-triazin (Sigma-Aldrich, St Louis, MO, USA) (27) ...