Labshake search
Citations for Millipore Sigma :
2751 - 2800 of 10000+ citations for Human Immunodeficiency Virus GP120 Protein HIV 1 Clade E CM244 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... precleared cell extracts were incubated with the indicated antibody for 4 hours at 4°C with rotation followed by 1 hour of pull-down by 1:1 protein A/G agarose beads (GE, 17061801, 17127901) or FLAG/Myc beads (FLAG resin: Sigma, A2220; Myc resin: Sigma, E6654). Immunoprecipitates were washed with lysis buffer three times before electrophoresis.
-
bioRxiv - Neuroscience 2019Quote: ... Membranes were then washed twice 5 min in TBST and incubated with the primary antibody over night at 4°C (human and mouse a-syn: 610786 BD Biosciences; human α-syn: 804-258-1001, Enzo Life Science; beta-actin: A4700, Sigma). After incubation with the first antibody ...
-
bioRxiv - Immunology 2022Quote: Concentrations of human serum albumin in human plasma and bronchoalveloar lavage fluid were measured using an ELISA kit from Sigma Aldrich (Cat. #RAB0603) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... HeLa cells were seeded at a density of 2.5×106 cells/well in 12-well plates and spin-fected (2000 rpm for 2 hours at 37°C) with increasing concentrations of virus in the presence of 8µg/mL polybrene (Millipore TR-003-G lot#3287963). The next day ...
-
bioRxiv - Cell Biology 2022Quote: ... Near-confluent cells were transduced by aspirating the medium and adding 1ml of the respective virus diluted in 1ml of EGM2 with 4mg/ml polybrene (Sigma, Prod. No. H9268-5G). Cells were then left to incubate for 6h at 37°C and 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: ... on day 3 of activation (Fig. S1A) 250 µl of concentrated virus was preincubated with 8 µg/mL polybrene (EMD Millipore, TR-1003-G) for 30 min on ice ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were further incubated in medium containing 300 nM tamoxifen for 48 h and then incubated with two-fold dilutions of AdV-C5-EGFP stock virus in DMEM medium (Sigma-Aldrich, cat. no. D6429) supplemented with 7.5% fetal calf serum (Gibco/ Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Boost vaccination was performed with the homologous virus inactivated at 4°C for 3 days with 0.1% beta propiolactone (BPL) (Sigma-Aldrich Corporation, St. Louis, MO) as previously described (66) ...
-
Parkinson’s VPS35[D620N] mutation induces LRRK2 mediated lysosomal association of RILPL1 and TMEM55BbioRxiv - Neuroscience 2023Quote: MEF cells were plated in 10 cm dishes to give a 70% confluency the following day for viral transduction by the addition of 5 ml of virus with 5 ml of fresh medium and 10 μg/ml Polybrene (Sigma-Aldrich, TR-1003-G). After 24h incubation ...
-
bioRxiv - Cancer Biology 2023Quote: ... RMG-1 ARID1A-WT and ARID1A-KO cells were seeded at a density of 2.5×106 cells/well in 12-well plates and spin-fected (2000 rpm for 2 hours at 37°C) with increasing concentrations of virus in the presence of 8µg/mL polybrene (Millipore TR-003-G lot#3287963). The next day ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 mL/well cell-virus suspension was seeded into 50 µg/mL rat tail collagen type I (Sigma Aldrich, St. Louise, MO USA) coated 6-well plates ...
-
bioRxiv - Microbiology 2019Quote: ... RPE-1 cells (ATCC® CRL-4000™) and Human foreskin fibroblasts (Hff1; ATCC® SCRC-1041™) were maintained in DMEM (Sigma) supplemented with 10% heat-inactivated FBS and 100 U/mL penicillin and 100 µg/mL streptomycin ...
-
bioRxiv - Physiology 2021Quote: ... injection of sterile glucose solution (10% glucose in 0.9% saline at 1 g/kg body weight for the GTT) or human insulin (0.75 unit/kg body weight, I9278, Sigma Aldrich for the ITT), following which pin-prick blood samples were collected up to 120 min post-injection ...
-
bioRxiv - Cell Biology 2021Quote: Binding of RBD to the surface of cells was measured by flow cytometry after incubation with increasing doses of human lactoferrin (0, 1, 5 and 10 mM) (Sigma Aldrich Cat#: L1294) in a final volume of 100 μL of culture medium ...
-
bioRxiv - Molecular Biology 2020Quote: Lentiviral pLKO.1-puro empty vector control plasmid and human TENT4A shRNA pLKO.1-puro plasmid (clone TRCN0000053036, target sequence CCAACAATCAGACCAGGTTTA) were obtained from Sigma (Mission shRNA library). Lentiviruses were produced in 293FT cells ...
-
Microhomology-Mediated Circular DNA Formation from Oligonucleosomal Fragments During SpermatogenesisbioRxiv - Genomics 2023Quote: ... The cauda epididymis was quickly cut into pieces and incubated in 1 ml pre-warmed human tubal fluid (HTF) (Millipore, MR-070-D) for 15 min at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... diluted in FACS-blocking buffer (mixture of 0.66% human/rabbit/mouse serum, Sigma-Aldrich, and 1% Bovine Serum Albumin, Sigma-Aldrich in PBS) for 30 minutes at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... and immediately incubated at 4°C in the primary antibody against the N-terminus of human Fos (overnight, 1:2000; Rabbit polyclonal, ABE457, Millipore; RRID: AB_2631318 (56) (Exp ...
-
bioRxiv - Immunology 2023Quote: ... ELISA signal in each elution sample was checked using 1:5000 diluted goat anti-human IgG (Fab specific) HRP-conjugated secondary antibodies (Sigma-Aldrich, A0293-1ML). Elution fractions showing an ELISA signal were pooled and concentrated under vacuum to a volume of ∼1 μL ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The CAR T cell product was cultivated in RPMI+10%FBS+1%PS at 37°C with 5% CO2 for experiments and cryopreserved as 10×106 cells/mL in 1 mL 90% heat-inactivated Human AB Serum (Sigma-Aldrich, Cat.#H4522) +10% DMSO in liquid nitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... Both mouse and human brain sections were labeled for TH (mouse monoclonal, clone LNC1, 1:2000, Catalog No. MAB318, EMD Millipore, Burlington, MA) and VGLUT2 (rabbit polyclonal ...
-
bioRxiv - Microbiology 2020Quote: ... protein complexes were precipitated using Protein A agarose beads (Sigma, St. Louis, MO, USA). The precipitated material was analyzed by western blot ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: The protein content was analysed with the Bicinchonic Acid Protein Assay Kit (Sigma-Aldrich) according to the manufacturer’s protocol with minor adjustments ...
-
bioRxiv - Cell Biology 2021Quote: The Protein A slurry was prepared by washing 1.5 g Protein A Sepharose (Sigma) 4 times in 1X Tris Buffered Saline (1X TBS ...
-
bioRxiv - Neuroscience 2021Quote: ... Bradford protein assay was used to quantify total protein levels (Bradford, Sigma-Aldrich, USA) and to normalize BDNF data.
-
bioRxiv - Physiology 2022Quote: ... Protein carbonylation was assessed with an Oxyblot protein oxidation detection kit (#S7150, Merck Millipore) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Protein precipitation was carried out using ProteoExtract Protein Precipitation Kit (EMD Millipore, 539180-1KIT) according to the manufacturer’s protocol and submitted for MS analysis to the Taplin Biological Mass Spectrometry Facility.
-
The CB1 receptor interacts with cereblon and drives cereblon deficiency-associated memory shortfallsbioRxiv - Neuroscience 2023Quote: ... Bound proteins were captured with Protein G agarose for 4 h (Sigma-Aldrich, #17061801), spun at low speed ...
-
bioRxiv - Cell Biology 2023Quote: ... and total (i.e. nonphosphorylated) protein levels were normalized to tubulin protein levels (Sigma-Aldrich, #T6557 ...
-
bioRxiv - Molecular Biology 2024Quote: Total carbonylated proteins were quantified using OxyBlot Protein Oxidation Detection Kit (Millipore, Billerica, MA) following manufacturer’s instructions using 15 μg of total protein detected with rabbit anti-DNP antibodies (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... 500 μg of protein were added to washed agarose protein A beads (Merck Millipore) and incubated on a rotating wheel for 1 h at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... and visualized using InstantBlue Coomassie Protein Stain or ReadyBlue Protein Gel Stain (Sigma Aldrich).
-
bioRxiv - Immunology 2022Quote: ... 100 μL of 1:5000 diluted Goat anti-human secondary antibody was added into each well and incubated at 37°C for 1 hr (Goat Anti-Human IgG γ Chain Specific HRP conjugated, species Adsorbed (Human IgM, IgD, and IgA) Polyclonal Antibody for IgG (Cat# AP504P, EMD Millipore, Burlington, MA), Goat Anti-Human IgA ...
-
bioRxiv - Plant Biology 2020Quote: ... 2015) e cleaned using stage-tips preparations with 3 plugs of Empore polystyrenedivinylbenzene (SBD-XC) copolymer disks (Sigma Aldrich, MO, USA) for solid phase extraction following the manufacturers instructions.
-
bioRxiv - Developmental Biology 2019Quote: Embryos designated for hematoxylin and eosin (H&E) staining were dissected and fixed overnight in 10% neutral buffered formalin solution (Sigma-Aldrich) at room temperature (RT ...
-
bioRxiv - Cancer Biology 2021Quote: ... After 10 days constructs were fixed in 4% paraformaldehyde and embedded in paraffin and stained with H&E and stained for Fibronectin with FN1 antibody (F3648, Sigma Aldrich). For each construct the number of cells invading into the collagen was counted in at least five different fields of view under light microscopy ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.01 mg aprotinin and 0.1 mM trans-epoxysuccinyl-L-leucyl amido (4-guanidino) butane (E-64) as a protease inhibitors (Sigma Aldrich®) and lysed by sonication (5 pulses for 1 min each ...
-
bioRxiv - Immunology 2021Quote: ... HEK293 and HEK293T cells (gifts from Caetano Reis e Sousa, The Francis Crick Institute, UK) were maintained in DMEM (Sigma-Aldrich) containing 4.5 g/L glucose ...
-
bioRxiv - Microbiology 2021Quote: ... PMH were cultured in hepatocyte culture medium (William’s E medium, GlutaMAX™ Supplement, Gibco™ 32551020; 100 U/ml penicillin/streptomycin, Sigma P4333 ...
-
bioRxiv - Molecular Biology 2022Quote: ... by negative selection and activated for 72 hr in the presence of LPS (50 μg/ml final concentration, E. coli 0111:B4; Sigma-Aldrich) plus IL4 (2.5 ng/ml final concentration ...
-
bioRxiv - Cancer Biology 2021Quote: ... The retrieved cells were seeded on collagen-treated vessels (at a density of 150,000 viable cells per cm2) and maintained in Williams’ medium E (Sigma, Darmstadt, Germany) supplemented with 1 μM dexamethasone ...
-
bioRxiv - Cell Biology 2022Quote: ... The cells were then incubated with 1 ml of SF DMEM containing the broad-spectrum hydroxamate metalloproteinases inhibitor CT1746 (100 μM) and the protease inhibitor cocktail (a mixture of aprotinin, bestatin, E-64, leupeptin and pepstatin A)(SIGMA, P1860) in the presence or absence (control ...
-
bioRxiv - Neuroscience 2021Quote: ... MDMi cells were treated with 500 nM stable human Aβ1-42 oligomers (180222EMH, gift from Crossbeta) or 100 ng/mL lipopolysaccharide in PBS (LPS, L4391-1MG, E. coli 0111:B4, Sigma-Aldrich). As a control for the oligomer and LPS condition ...
-
bioRxiv - Neuroscience 2022Quote: ... Time-mated pregnant rhesus macaques at 127 days of gestation (80% of term gestation) were treated with intra-amniotic LPS 1mg (E. coli O55:B5, Sigma-Aldrich) diluted in 1 mL of sterile saline (LPS) ...
-
bioRxiv - Plant Biology 2020Quote: ... As negative control one set of samples was pre-incubated with 20 μM E-64 (Sigma-Aldrich, St. louis, Mississippi, USA). Subsequently ...
-
bioRxiv - Biochemistry 2019Quote: EcSerRS (from E. coli strain B ER2560) and SaSerRS (from S. aureus seg50 (1150)) were cloned into pET52b(+) vector (Merck Millipore, Germany) using the NcoI and SacI restriction sites allowing for the production of protein with a thrombin cleavable C-terminal His10-tag ...
-
bioRxiv - Microbiology 2019Quote: Peptidoglycan-derived stem peptide fragments including ‘A-E-K-A-A’ pentapeptide (L-Ala-D-Glu-L-Lys-D-Ala-D-Ala (Sigma-Aldrich), ‘K-A-A’ tripeptide (acetyl-L-Lys-D-Ala-D-Ala ...
-
bioRxiv - Immunology 2020Quote: ... in the central-left abdomen area and 10 μg of LPS (from E. coli, serotype 055:B5 and deproteinized; Sigma-Aldrich) in 100 μl of PBS in the centralright abdomen area ...
-
bioRxiv - Neuroscience 2022Quote: ... media was aspirated and cells were exposed to 10/50 μg/mL Lipopolysaccharide (LPS; E. coli strain 0111:B4; Sigma-Aldrich) (MilliQ H2O vehicle ...
-
bioRxiv - Immunology 2022Quote: ... HLA-E expressing K562 cells were sorted and maintained in complete RPMI supplemented with 2 µg/mL blasticidin (Sigma-Aldrich, Belgium). All cells were cultured at 37°C with 5% CO2 ...