Labshake search
Citations for Millipore Sigma :
2201 - 2250 of 10000+ citations for Human Immunodeficiency Virus GP120 Protein HIV 1 Clade A KNH1144 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: The puromycin selection gene was replaced with green fluorescent protein (eGFP) cDNA in Lentiviral pLKO.1 plasmid (Sigma). shRNA oligos (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: Antibodies against the following proteins were used at indicated dilutions: anti-acTub (Sigma-Aldrich T7451, mouse 1:2,000), anti-Arl13b (Proteintech 17711-1-AP ...
-
bioRxiv - Neuroscience 2021Quote: ... Astrocytes were evaluated by immunostaining for glial fibrillary acidic protein (GFAP; monoclonal mouse anti-GFAP; 1:500; Millipore, Burlington ...
-
bioRxiv - Pathology 2021Quote: ... was homogenized with protein lysis buffer (50mM Tris-HCL pH 8.0, 150mM NaCl, 1% NP-40, 0.5mM PMSF(Sigma) and cOmplete protease inhibitor (Roche) ...
-
bioRxiv - Microbiology 2019Quote: ... The purified protein was concentrated to 15 mg ml−1 using a centrifugal concentration device (Amicon ultra, Millipore) before storage at 193K ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 mg of protein lysate was incubated overnight with 30 μL Anti-FLAG M2 Magnetic Beads (Sigma-Aldrich) at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Proteins were separated by SDS-PAGE and analyzed by WB using anti-Flag (Sigma-Aldrich F3165; 1:7500), anti-RPL3 (Proteintech 11005-1-AP ...
-
bioRxiv - Systems Biology 2022Quote: The proteins were extracted from the frozen cell pellets by lysing the cells with 1% SDC (Sigma, D6750) in HNN Buffe pH 7.8 (50 mM HEPES ...
-
bioRxiv - Molecular Biology 2024Quote: ... or with 1-5 μg of the appropriate antibody and then with Protein G Sepharose beads (Sigma, P3296). The following day ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Sized proteins were concentrated to >50 mg mL-1 using 10 kDa molecular weight cut-off concentrators (Millipore), flash frozen on liquid nitrogen ...
-
bioRxiv - Genetics 2023Quote: ... Immunoprecipitation was performed on total-protein lysate using 1 μg of rabbit polyclonal TTC29 antibody (HPA061473, Sigma-Aldrich) and 15 μl of Protein A/G magnetics beads (Bio-Ademtec ...
-
bioRxiv - Microbiology 2023Quote: ... and cells were probed using primary antibodies to VZV proteins IE62 (mouse mAb; EMD Millipore MAB8616; 1:200), capsid-ORF23 (polyclonal rabbit ...
-
bioRxiv - Neuroscience 2023Quote: ... The primary antibodies used were anti-glial fibrillary acidic protein (GFAP) antibody (dilution; 1:100, Sigma-Aldrich (G6171), St ...
-
bioRxiv - Biochemistry 2023Quote: mAb TnI-1 (IgG1) was purified from mouse hybridoma ascites fluid using Protein G chromatography (Millipore Sigma P7700). TnI-1 IgG eluted with 50 mM glycine-HCl ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were pre-cleared for 1 h with protein A Sepharose CL-4B (Sigma-Aldrich, 17-0780-01) beads blocked with 0.2 µg/µl sonicated herring sperm DNA (Thermo Fisher ...
-
bioRxiv - Microbiology 2023Quote: ... Purified proteins were concentrated to >15 mg ml−1 using 30-kDa MWCO centrifugal filter units (Millipore Sigma), aliquoted ...
-
bioRxiv - Microbiology 2023Quote: ... Purified proteins were concentrated to >10 mg mL−1 using a 30 kDa MWCO centrifugal filter (Millipore Sigma), aliquoted ...
-
bioRxiv - Microbiology 2023Quote: ... Enriched proteins were denatured in U/T buffer (6 M urea, 2 M thiourea, 1 mM DTT (Sigma), 10 mM HEPES ...
-
bioRxiv - Neuroscience 2023Quote: ... the primary antibody was glial fibrillary acidic protein (GFAP) (1:1000 dilution; Millipore, Temecula, CA, USA; Cat. #MAB360). Secondary antibodies were conjugated to Alexa Fluor 594 (donkey anti-mouse ...
-
bioRxiv - Plant Biology 2023Quote: ... The eluted protein was concentrated to 1 mg/ml using Amicon Ultra 10 kDa MWCO filters (Millipore Sigma). Size-exclusion chromatography was performed using a Superose 6 10/300 GL column (Cytiva ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were probed using mouse anti-FLAG antibody (Monoclonal anti-FLAG M2 antibody, Sigma-Aldrich, F3165, 1:2000), or anti-beta actin (Abcam ...
-
bioRxiv - Plant Biology 2024Quote: ... 0.5 mg TTN5 protein was combined with 1 U of agarose bead-coupled alkaline phosphatase (Sigma Aldrich, Germany) for degradation of bound GDP to GMP and Pi in the presence of 1.5-fold molar excess of non-hydrolyzable GTP analog GppCp (Jena Bioscience ...
-
bioRxiv - Microbiology 2024Quote: The culture supernatants containing the secreted proteins were centrifugated (1 h, 30,000xg, 10 °C) and sterilized by filtration (0.22 µm; Express Plus; Merck Millipore). The supernatants were equilibrated to pH 7 with 0.5 mM NaOH and the proteins were purified using two ion exchange chromatographies (Fig ...
-
bioRxiv - Molecular Biology 2021Quote: Protein-G (Protein G Sepharose® 4 Fast, cat# GE17-0618-01) or Protein-A (ProteinA-Sepharose® 4, cat#P9424 Millipore) beads were washed twice with 1x PBS and twice with IP100 buffer (25 mM Tris-HCl 7.9 ...
-
bioRxiv - Molecular Biology 2022Quote: Antibodies that recognize the following proteins and epitope tags were used: glucose-6-phosphate dehydrogenase (G6PDH; Sigma-Aldrich A-9521, 1:20,000 or 1:50,000), H2B (Active motif 39237 ...
-
bioRxiv - Cell Biology 2021Quote: ... precleared cell extracts were incubated with the indicated antibody for 4 hours at 4°C with rotation followed by 1 hour of pull-down by 1:1 protein A/G agarose beads (GE, 17061801, 17127901) or FLAG/Myc beads (FLAG resin: Sigma, A2220; Myc resin: Sigma, E6654). Immunoprecipitates were washed with lysis buffer three times before electrophoresis.
-
bioRxiv - Neuroscience 2019Quote: ... Membranes were then washed twice 5 min in TBST and incubated with the primary antibody over night at 4°C (human and mouse a-syn: 610786 BD Biosciences; human α-syn: 804-258-1001, Enzo Life Science; beta-actin: A4700, Sigma). After incubation with the first antibody ...
-
bioRxiv - Immunology 2022Quote: Concentrations of human serum albumin in human plasma and bronchoalveloar lavage fluid were measured using an ELISA kit from Sigma Aldrich (Cat. #RAB0603) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... RPE-1 cells (ATCC® CRL-4000™) and Human foreskin fibroblasts (Hff1; ATCC® SCRC-1041™) were maintained in DMEM (Sigma) supplemented with 10% heat-inactivated FBS and 100 U/mL penicillin and 100 µg/mL streptomycin ...
-
bioRxiv - Physiology 2021Quote: ... injection of sterile glucose solution (10% glucose in 0.9% saline at 1 g/kg body weight for the GTT) or human insulin (0.75 unit/kg body weight, I9278, Sigma Aldrich for the ITT), following which pin-prick blood samples were collected up to 120 min post-injection ...
-
bioRxiv - Cell Biology 2021Quote: Binding of RBD to the surface of cells was measured by flow cytometry after incubation with increasing doses of human lactoferrin (0, 1, 5 and 10 mM) (Sigma Aldrich Cat#: L1294) in a final volume of 100 μL of culture medium ...
-
bioRxiv - Molecular Biology 2020Quote: Lentiviral pLKO.1-puro empty vector control plasmid and human TENT4A shRNA pLKO.1-puro plasmid (clone TRCN0000053036, target sequence CCAACAATCAGACCAGGTTTA) were obtained from Sigma (Mission shRNA library). Lentiviruses were produced in 293FT cells ...
-
Microhomology-Mediated Circular DNA Formation from Oligonucleosomal Fragments During SpermatogenesisbioRxiv - Genomics 2023Quote: ... The cauda epididymis was quickly cut into pieces and incubated in 1 ml pre-warmed human tubal fluid (HTF) (Millipore, MR-070-D) for 15 min at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... diluted in FACS-blocking buffer (mixture of 0.66% human/rabbit/mouse serum, Sigma-Aldrich, and 1% Bovine Serum Albumin, Sigma-Aldrich in PBS) for 30 minutes at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... and immediately incubated at 4°C in the primary antibody against the N-terminus of human Fos (overnight, 1:2000; Rabbit polyclonal, ABE457, Millipore; RRID: AB_2631318 (56) (Exp ...
-
bioRxiv - Immunology 2023Quote: ... ELISA signal in each elution sample was checked using 1:5000 diluted goat anti-human IgG (Fab specific) HRP-conjugated secondary antibodies (Sigma-Aldrich, A0293-1ML). Elution fractions showing an ELISA signal were pooled and concentrated under vacuum to a volume of ∼1 μL ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The CAR T cell product was cultivated in RPMI+10%FBS+1%PS at 37°C with 5% CO2 for experiments and cryopreserved as 10×106 cells/mL in 1 mL 90% heat-inactivated Human AB Serum (Sigma-Aldrich, Cat.#H4522) +10% DMSO in liquid nitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... Both mouse and human brain sections were labeled for TH (mouse monoclonal, clone LNC1, 1:2000, Catalog No. MAB318, EMD Millipore, Burlington, MA) and VGLUT2 (rabbit polyclonal ...
-
bioRxiv - Cell Biology 2021Quote: ... HeLa cells were seeded at a density of 2.5×106 cells/well in 12-well plates and spin-fected (2000 rpm for 2 hours at 37°C) with increasing concentrations of virus in the presence of 8µg/mL polybrene (Millipore TR-003-G lot#3287963). The next day ...
-
bioRxiv - Cell Biology 2022Quote: ... Near-confluent cells were transduced by aspirating the medium and adding 1ml of the respective virus diluted in 1ml of EGM2 with 4mg/ml polybrene (Sigma, Prod. No. H9268-5G). Cells were then left to incubate for 6h at 37°C and 5% CO2 ...
-
Parkinson’s VPS35[D620N] mutation induces LRRK2 mediated lysosomal association of RILPL1 and TMEM55BbioRxiv - Neuroscience 2023Quote: MEF cells were plated in 10 cm dishes to give a 70% confluency the following day for viral transduction by the addition of 5 ml of virus with 5 ml of fresh medium and 10 μg/ml Polybrene (Sigma-Aldrich, TR-1003-G). After 24h incubation ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were further incubated in medium containing 300 nM tamoxifen for 48 h and then incubated with two-fold dilutions of AdV-C5-EGFP stock virus in DMEM medium (Sigma-Aldrich, cat. no. D6429) supplemented with 7.5% fetal calf serum (Gibco/ Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Boost vaccination was performed with the homologous virus inactivated at 4°C for 3 days with 0.1% beta propiolactone (BPL) (Sigma-Aldrich Corporation, St. Louis, MO) as previously described (66) ...
-
bioRxiv - Cancer Biology 2023Quote: ... RMG-1 ARID1A-WT and ARID1A-KO cells were seeded at a density of 2.5×106 cells/well in 12-well plates and spin-fected (2000 rpm for 2 hours at 37°C) with increasing concentrations of virus in the presence of 8µg/mL polybrene (Millipore TR-003-G lot#3287963). The next day ...
-
bioRxiv - Cell Biology 2023Quote: ... on day 3 of activation (Fig. S1A) 250 µl of concentrated virus was preincubated with 8 µg/mL polybrene (EMD Millipore, TR-1003-G) for 30 min on ice ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 mL/well cell-virus suspension was seeded into 50 µg/mL rat tail collagen type I (Sigma Aldrich, St. Louise, MO USA) coated 6-well plates ...
-
bioRxiv - Microbiology 2020Quote: ... protein complexes were precipitated using Protein A agarose beads (Sigma, St. Louis, MO, USA). The precipitated material was analyzed by western blot ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: The protein content was analysed with the Bicinchonic Acid Protein Assay Kit (Sigma-Aldrich) according to the manufacturer’s protocol with minor adjustments ...
-
bioRxiv - Cell Biology 2021Quote: The Protein A slurry was prepared by washing 1.5 g Protein A Sepharose (Sigma) 4 times in 1X Tris Buffered Saline (1X TBS ...
-
bioRxiv - Neuroscience 2021Quote: ... Bradford protein assay was used to quantify total protein levels (Bradford, Sigma-Aldrich, USA) and to normalize BDNF data.