Labshake search
Citations for Millipore Sigma :
2101 - 2150 of 10000+ citations for Human Immunodeficiency Virus GP120 Protein HIV 1 Clade A KNH1144 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2021Quote: ... injection of sterile glucose solution (10% glucose in 0.9% saline at 1 g/kg body weight for the GTT) or human insulin (0.75 unit/kg body weight, I9278, Sigma Aldrich for the ITT), following which pin-prick blood samples were collected up to 120 min post-injection ...
-
bioRxiv - Cell Biology 2021Quote: Binding of RBD to the surface of cells was measured by flow cytometry after incubation with increasing doses of human lactoferrin (0, 1, 5 and 10 mM) (Sigma Aldrich Cat#: L1294) in a final volume of 100 μL of culture medium ...
-
bioRxiv - Molecular Biology 2020Quote: Lentiviral pLKO.1-puro empty vector control plasmid and human TENT4A shRNA pLKO.1-puro plasmid (clone TRCN0000053036, target sequence CCAACAATCAGACCAGGTTTA) were obtained from Sigma (Mission shRNA library). Lentiviruses were produced in 293FT cells ...
-
Microhomology-Mediated Circular DNA Formation from Oligonucleosomal Fragments During SpermatogenesisbioRxiv - Genomics 2023Quote: ... The cauda epididymis was quickly cut into pieces and incubated in 1 ml pre-warmed human tubal fluid (HTF) (Millipore, MR-070-D) for 15 min at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... diluted in FACS-blocking buffer (mixture of 0.66% human/rabbit/mouse serum, Sigma-Aldrich, and 1% Bovine Serum Albumin, Sigma-Aldrich in PBS) for 30 minutes at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... and immediately incubated at 4°C in the primary antibody against the N-terminus of human Fos (overnight, 1:2000; Rabbit polyclonal, ABE457, Millipore; RRID: AB_2631318 (56) (Exp ...
-
bioRxiv - Immunology 2023Quote: ... ELISA signal in each elution sample was checked using 1:5000 diluted goat anti-human IgG (Fab specific) HRP-conjugated secondary antibodies (Sigma-Aldrich, A0293-1ML). Elution fractions showing an ELISA signal were pooled and concentrated under vacuum to a volume of ∼1 μL ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The CAR T cell product was cultivated in RPMI+10%FBS+1%PS at 37°C with 5% CO2 for experiments and cryopreserved as 10×106 cells/mL in 1 mL 90% heat-inactivated Human AB Serum (Sigma-Aldrich, Cat.#H4522) +10% DMSO in liquid nitrogen ...
-
bioRxiv - Neuroscience 2019Quote: ... Membranes were then washed twice 5 min in TBST and incubated with the primary antibody over night at 4°C (human and mouse a-syn: 610786 BD Biosciences; human α-syn: 804-258-1001, Enzo Life Science; beta-actin: A4700, Sigma). After incubation with the first antibody ...
-
bioRxiv - Immunology 2022Quote: Concentrations of human serum albumin in human plasma and bronchoalveloar lavage fluid were measured using an ELISA kit from Sigma Aldrich (Cat. #RAB0603) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... HeLa cells were seeded at a density of 2.5×106 cells/well in 12-well plates and spin-fected (2000 rpm for 2 hours at 37°C) with increasing concentrations of virus in the presence of 8µg/mL polybrene (Millipore TR-003-G lot#3287963). The next day ...
-
bioRxiv - Cell Biology 2022Quote: ... Near-confluent cells were transduced by aspirating the medium and adding 1ml of the respective virus diluted in 1ml of EGM2 with 4mg/ml polybrene (Sigma, Prod. No. H9268-5G). Cells were then left to incubate for 6h at 37°C and 5% CO2 ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were further incubated in medium containing 300 nM tamoxifen for 48 h and then incubated with two-fold dilutions of AdV-C5-EGFP stock virus in DMEM medium (Sigma-Aldrich, cat. no. D6429) supplemented with 7.5% fetal calf serum (Gibco/ Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Boost vaccination was performed with the homologous virus inactivated at 4°C for 3 days with 0.1% beta propiolactone (BPL) (Sigma-Aldrich Corporation, St. Louis, MO) as previously described (66) ...
-
Parkinson’s VPS35[D620N] mutation induces LRRK2 mediated lysosomal association of RILPL1 and TMEM55BbioRxiv - Neuroscience 2023Quote: MEF cells were plated in 10 cm dishes to give a 70% confluency the following day for viral transduction by the addition of 5 ml of virus with 5 ml of fresh medium and 10 μg/ml Polybrene (Sigma-Aldrich, TR-1003-G). After 24h incubation ...
-
bioRxiv - Cancer Biology 2023Quote: ... RMG-1 ARID1A-WT and ARID1A-KO cells were seeded at a density of 2.5×106 cells/well in 12-well plates and spin-fected (2000 rpm for 2 hours at 37°C) with increasing concentrations of virus in the presence of 8µg/mL polybrene (Millipore TR-003-G lot#3287963). The next day ...
-
bioRxiv - Cell Biology 2023Quote: ... on day 3 of activation (Fig. S1A) 250 µl of concentrated virus was preincubated with 8 µg/mL polybrene (EMD Millipore, TR-1003-G) for 30 min on ice ...
-
bioRxiv - Microbiology 2020Quote: ... protein complexes were precipitated using Protein A agarose beads (Sigma, St. Louis, MO, USA). The precipitated material was analyzed by western blot ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: The protein content was analysed with the Bicinchonic Acid Protein Assay Kit (Sigma-Aldrich) according to the manufacturer’s protocol with minor adjustments ...
-
bioRxiv - Cell Biology 2021Quote: The Protein A slurry was prepared by washing 1.5 g Protein A Sepharose (Sigma) 4 times in 1X Tris Buffered Saline (1X TBS ...
-
bioRxiv - Neuroscience 2021Quote: ... Bradford protein assay was used to quantify total protein levels (Bradford, Sigma-Aldrich, USA) and to normalize BDNF data.
-
bioRxiv - Physiology 2022Quote: ... Protein carbonylation was assessed with an Oxyblot protein oxidation detection kit (#S7150, Merck Millipore) following the manufacturer’s instructions ...
-
The CB1 receptor interacts with cereblon and drives cereblon deficiency-associated memory shortfallsbioRxiv - Neuroscience 2023Quote: ... Bound proteins were captured with Protein G agarose for 4 h (Sigma-Aldrich, #17061801), spun at low speed ...
-
bioRxiv - Cell Biology 2023Quote: ... and total (i.e. nonphosphorylated) protein levels were normalized to tubulin protein levels (Sigma-Aldrich, #T6557 ...
-
bioRxiv - Molecular Biology 2024Quote: Total carbonylated proteins were quantified using OxyBlot Protein Oxidation Detection Kit (Millipore, Billerica, MA) following manufacturer’s instructions using 15 μg of total protein detected with rabbit anti-DNP antibodies (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... 500 μg of protein were added to washed agarose protein A beads (Merck Millipore) and incubated on a rotating wheel for 1 h at 4°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... Protein precipitation was carried out using ProteoExtract Protein Precipitation Kit (EMD Millipore, 539180-1KIT) according to the manufacturer’s protocol and submitted for MS analysis to the Taplin Biological Mass Spectrometry Facility.
-
bioRxiv - Immunology 2022Quote: ... 100 μL of 1:5000 diluted Goat anti-human secondary antibody was added into each well and incubated at 37°C for 1 hr (Goat Anti-Human IgG γ Chain Specific HRP conjugated, species Adsorbed (Human IgM, IgD, and IgA) Polyclonal Antibody for IgG (Cat# AP504P, EMD Millipore, Burlington, MA), Goat Anti-Human IgA ...
-
bioRxiv - Neuroscience 2019Quote: ... Urocortin (rat) protein (Millipore Sigma, ~2μl of 40μM in 1x PBS + 0.1% acetic acid ...
-
bioRxiv - Biochemistry 2021Quote: ... protein standards (Merck Sigma-Aldrich) specified in the Supplementary Material were separated on the same column.
-
bioRxiv - Biochemistry 2020Quote: ... Protein A/G beads (Millipore) were then added for overnight incubation at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein G affinity beads (Sigma) were added to the lysate (for anti-D-cys immunoprecipitation only ...
-
bioRxiv - Microbiology 2021Quote: ... 2x protein inhibitor complex (Sigma) in PBS was added and protein levels were normalized by Bradford assay ...
-
bioRxiv - Neuroscience 2021Quote: ... 2.0 Protein Detection System (Millipore). Membranes were imaged using a chemiluminescent SuperSignal West Femto Maximum Sensitivity Substrate (34095 ...
-
bioRxiv - Cancer Biology 2021Quote: Protein A Dyna-beads (Millipore) were used for immunoprecipitation ...
-
bioRxiv - Physiology 2022Quote: ... Protein G Agarose beads (Millipore) and AMPK-IP buffer (50 mmol l-1 NaCl ...
-
bioRxiv - Biophysics 2022Quote: ... 1x Protein Inhibitor Cocktail (Sigma), 1 mM PMSF (Sigma) ...
-
bioRxiv - Cell Biology 2022Quote: BCA protein assay (Sigma-Aldrich) was performed to measure protein concentrations ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5 mM Cas9 protein (Sigma), and 300 mM KCl ...
-
bioRxiv - Plant Biology 2019Quote: ... Myelin basic protein (Sigma-Aldrich) was used as an artificial substrate ...
-
bioRxiv - Cancer Biology 2020Quote: ... protein G agarose (60µL, Millipore) was incubated with anti-phosphotyrosine antibodies (12µg 4G10 (Millipore) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein A Sepharose beads (Sigma) were then added and the samples were incubated at 4°C for another hour with rotation ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein A-agarose beads (Millipore) and an antibody against H3K9ac (Millipore ...
-
bioRxiv - Cell Biology 2021Quote: ... or S-protein beads (Millipore) were used ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein G sepharose beads (Sigma) were then placed in the mixture for 4 hours at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein G agarose beads (Sigma) were activated by immersing in water and incubated in IP buffer (300 mM NaCl ...
-
bioRxiv - Microbiology 2021Quote: ... Protein G Magnetic beads (Millipore) were used for pull-down of PPARG-chromatin complex and analysed using PCR after reversal of cross-linking.
-
bioRxiv - Immunology 2022Quote: ... and either Ovalbumin protein (Sigma) or mMOGtag protein.
-
Phosphorylation of the Smooth Muscle Master Splicing Regulator RBPMS Regulates its Splicing ActivitybioRxiv - Molecular Biology 2022Quote: ... Myelin Basic Protein (MBP; Millipore) was used as a positive control ...
-
bioRxiv - Neuroscience 2022Quote: ... 2.0 Protein Detection System (Millipore). The following antibodies were used ...