Labshake search
Citations for Millipore Sigma :
2151 - 2200 of 7143 citations for Borrelia burgdorferi sensu stricto B31 P39 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... The recombinant protein was expressed in Rossetta2(DE3) strain (EMD Millipore/Novagen). Expressed fragment was found in inclusion body thus the proteins were solubilized by 8M urea containing buffer (20mM Hepes pH7.8 ...
-
bioRxiv - Cell Biology 2019Quote: ... The target proteins were detected on the membranes by enhanced chemiluminescence (Millipore).
-
bioRxiv - Synthetic Biology 2020Quote: ... The culture supernatant was loaded onto a protein A-sepharose column (Millipore), and the bound antibody was eluted by the addition of 0.2 M glycine–HCl (pH 2.7) ...
-
bioRxiv - Biochemistry 2019Quote: ... gels were stained with InstantBlue™ Ultrafast Protein Stain (ISB1L, Sigma-Aldrich) according to the manufacturer’s instructions and the gels were imaged using LICOR Odyssey CLx ...
-
bioRxiv - Biochemistry 2019Quote: ... gels were stained with InstantBlue™ Ultrafast Protein Stain (ISB1L, Sigma-Aldrich) according to the manufacturer’s instructions and the gels were imaged using LICOR Odyssey CLx ...
-
bioRxiv - Cell Biology 2019Quote: ... The flow chamber was incubated with Protein G (Sigma, Cat. No. 08062) for 10 minutes followed by anti-his antibody (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... Complexes were pulled down using Dynabeads Protein A/G (Sigma-Aldrich, 14321D) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... Proteins were released by addition of 5 μg of RNase A (Sigma) in RNA digestion buffer (20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein was then transferred to a 0.45um Immobilon-P PVDF membrane (Millipore). After blocking for 1 hr in 5% nonfat dried milk in TBST ...
-
bioRxiv - Molecular Biology 2021Quote: ... The protein activity was measured by an ATPase activity kit (Sigma-Aldrich) as described by the manufacturer.
-
bioRxiv - Molecular Biology 2020Quote: ... TAP tagged proteins was captured using IgG sepharose fast flow beads (Sigma) and proceeded as described (33) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The separated proteins were transferred to a PVDF membrane (Millipore, 0.2 μm). The membrane was blocked in 5% nonfat dry milk (Biofroxx ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were detected with antibodies of γ-H2AX (Cat# 05-636, Millipore) and β-actin (Cat# 4967 ...
-
bioRxiv - Biochemistry 2019Quote: ... Proteins were filtrated using an Amicon Ultra 50K spin column (Sigma-Aldrich) to remove residual free dye.
-
bioRxiv - Neuroscience 2020Quote: ... anti-MBP (Myelin Basic Protein, rat polyclonal, 1:1000 Millipore MAB 386) or antimouse IgG (Biotin-SP AffiniPure ...
-
bioRxiv - Cell Biology 2021Quote: ... the proteins were electroeluted from gels onto Immobilon-F PVDF membranes (Millipore) at 100 mA for 16-18 hr at 4°C under wet blotting conditions (10 mM 3-[Cyclohexylamino]-1-propanesulfonic acid pH 11.0 ...
-
bioRxiv - Physiology 2021Quote: ... muscle whole-cell protein lysates were diluted in MPER buffer (Sigma-Aldrich) supplemented with protease and phosphatase inhibitor cocktails ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... BAL cytokines were profiled using a pre-mixed MILLIPLEX protein immunoassay (Millipore) that was read on a Bio-Plex 200 multiplex suspension array system (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... after which the proteins were transferred to Immobilon P membranes (Merck Millipore). After blocking the membrane with 5% skimmed milk in TBS-T buffer solution for 1 h at RT or overnight at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... purified Rv1019 protein (200μg) was emulsified in TitreMax Gold adjuvant (Sigma-Aldrich) and used to immunize two one-year old male rabbits by subcutaneous injection ...
-
bioRxiv - Microbiology 2020Quote: ... Fractions containing the desired protein were concentrated (Amicon Ultracel 100 K, Millipore) and further purified by size-exclusion chromatography (SEC ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were transferred onto an Immobilon P membrane (Millipore, Burlington, Massachusetts, USA) using TRANS-BLOT SD SEMI DRY TRANSFER CELL (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... The LAMP1 protein was detected with rabbit anti-LAMP1 (Sigma, Cat# SAB3500285) and horseradish peroxidase-conjugated mouse anti-rabbit (Millipore ...
-
bioRxiv - Biochemistry 2020Quote: ... the protein was overexpressed in Rosetta (DE3) pLysS E.coli cells (Millipore Sigma) and grown in Terrific Broth (TB ...
-
bioRxiv - Developmental Biology 2020Quote: ... We used 10µl G-protein coupled Sepharose beads per IP (SIGMA, P3296). Anti-Myc IPs were performed with 10µl Anti-Myc-Agarose bead (SIGMA ...
-
bioRxiv - Microbiology 2020Quote: ... and the resulting protein was concentrated by Amicon Ultra centrifugal filter (Millipore). The sample was diluted to 2.5 μg/ml and analyzed on a glycan 100 binding array provided by Creative Biochip ...
-
bioRxiv - Biophysics 2019Quote: ... Protein complex was concentrated with Amicon® Ultra Centrifugal Filters (Merck Millipore) and further purified on a Superdex 200 10/300 GL size-exclusion column (GE Healthcare ...
-
bioRxiv - Pathology 2020Quote: Dissolve proteins and FITCs in FluoroTag™ FITC Conjugation Kit(Sigma-Aldrich)kit buffer ...
-
bioRxiv - Cell Biology 2019Quote: ... Proteins were concentrated by ultrafiltration using Amicon Ultra centrifugal filters (Merck Millipore) with respective molecular weight cut offs ...
-
bioRxiv - Biochemistry 2019Quote: ... Strep-II-tagged proteins were bound to Strep-Tactin resin (EMD Millipore), washed with lysis buffer ...
-
bioRxiv - Genetics 2019Quote: ... Immunoprecipitated DNA was purified using 30 μl of protein A beads (Sigma), which were washed prior to DNA elution and cross-link reversal as previously described [16 ...
-
bioRxiv - Plant Biology 2019Quote: ... and salmon sperm DNA/protein A agarose beads (Millipore, Billerica, MA, USA) were used for ChIP experiments ...
-
bioRxiv - Biochemistry 2021Quote: ... The IMAC fractions containing the protein were concentrated by ultrafiltration (Amicon, Millipore) and then injected onto a Superdex 200 10/300 FPLC column (GE Healthcare ...
-
bioRxiv - Physiology 2020Quote: ... and protein bands were detected using Ponceau S staining solution (Sigma, P7170).
-
bioRxiv - Molecular Biology 2021Quote: ... Protein G Dynabeads were pre-equilibrated with mouse anti-FLAG antibody (Sigma) and added to clarified extract for 3 h at 4 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... 2.5 µl 5000x SPYRO Orange protein gel stain (Sigma-Aldrich catalog #S5692) to 1977.5 µl of buffer (20 mM MOPS ...
-
bioRxiv - Cell Biology 2019Quote: ... BCA assay reagents used for protein estimation were purchased from Sigma-Aldrich, ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 1000 units/ml ESGRO Recombinant Mouse LIF protein (Millipore #ESG1107), 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2021Quote: The solubilized protein was then loaded on a DEAE CL-6B (Sigma) column ...
-
bioRxiv - Biochemistry 2021Quote: ... The protein was applied to column packed with ATP-agarose (Sigma Aldrich) and the column was washed with buffer A (25 mM HEPES pH 7.5 ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were transferred to low fluorescence PVDF membrane (Millpore Sigma cat. # IPFL00010). REVERT total protein stain was used to detect and quantify transferred proteins ...
-
bioRxiv - Biochemistry 2021Quote: ... and equal amount of protein was subjected to benzonase nuclease (Millipore Sigma) treatment ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were transferred to a PVDF membrane (Merck Millipore cat. No. IPFL00010) after which the membrane was blocked using Odyssey Blocking buffer (PBS ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... The separated proteins were transferred onto PVDF membrane (Millipore, Billerica, Massachusetts, USA) using phosphate-based transfer buffer (10 mM sodium phosphate monobasic ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... anti-microtubule-associated protein 2 (MAP2) Alexa 555 (1:500, MAB3418A5; Millipore), antimicrotubule-associated protein 2 (MAP2 ...
-
bioRxiv - Physiology 2021Quote: ... The protein peak was collected and 20μM of iodoacetamide (Sigma-Aldrich; I1149) was added to the solution ...
-
bioRxiv - Bioengineering 2021Quote: ... the protein bands were developed using an enhanced chemiluminescent detection kit (Millipore). The optical bands were visualized in a Fuji Las-3000 dark box (FujiFilm) ...
-
An optimized ChIP-Seq framework for profiling of histone modifications in Chromochloris zofingiensisbioRxiv - Genomics 2021Quote: ... We used 50 mg of Protein-A-Sepharose beads (Sigma, P3391-1G), resuspended beads in 1 ml ChIP-buffer (1.1% Triton X-100 ...
-
bioRxiv - Cell Biology 2019Quote: Purified proteins in indicated concentrations were incubated with fluorescently labelled ssODN (Sigma) (0.25μM-6-FAM-39mer-5’GCGCGCCCATTGATACTAAATTCAAGGATGACTTATTTC3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... Proteins were then alkylated by the addition of 10 mM iodoacetamide (Sigma) for 15 min ...