Labshake search
Citations for Millipore Sigma :
2101 - 2150 of 4935 citations for SARS Coronavirus Spike Glycoprotein S1 Mosaic N Term E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... cells were treated for 16 hours with N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-phenylglycin T-butyl ester (DAPT) (Sigma Aldrich), an inhibitor of γ-secretase ...
-
bioRxiv - Neuroscience 2021Quote: ... received bilateral infusions of either vehicle (aCSF; pH 7.4; males n = 5; females n = 4) or the GABAA receptor agonist muscimol (Sigma Aldrich, M1523 ...
-
bioRxiv - Immunology 2022Quote: ... 2X reverse crosslinking buffer (2% SDS, 0.2mg/mL proteinase K, and 100mM N,N-Dimethylethylenediamine, pH 6.5 [Sigma Aldrich D158003]) was added at equal volume to transposed cells and reversal of crosslinks was performed at 37°C overnight with 600 rpm shaking ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were injected with the noradrenergic neuron specific neurotoxin N-(2-chloroethyl)-N-ethyl-2-bromobenzylamine hydrochloride (DSP4; Sigma, C8417) once at a dose of 50 mg/kg (i.p.) ...
-
bioRxiv - Genetics 2023Quote: ... Pregnant female mice were given one intraperitoneal (i.p.) injection of 30 mg/kg body weight of the carcinogen N-ethyl-N-nitrosourea (ENU, Sigma N3385) dissolved in phosphate-buffered citric acid (pH 5.8 ...
-
bioRxiv - Microbiology 2022Quote: ... The dried remainder of eluate 2 was dissolved in 50 µl dry acetonitrile and 50 µl N-(tert-butyldimethylsilyl)-N-methyltrifluoroacetamide containing 1% tert-butyldimethylsilyl chloride (Sigma) and kept at 70°C for 30 min ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... To the bead suspension was added 0.5 mL of 750 mM of N-(3-dimethylaminopropyl)-N’-ethylcarbodiimide hydrochloride (EDC) in water (Sigma-Aldrich) and the mixture was incubated for 20 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... animals were injected with N-[N-(3,5-Difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT) (Sigma, Cat no. D5942) (10 mg/kg/day ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The ML321 was dissolved in a small amount of N,N-dimethylacetamide (DMA) with previously heated Tween-80 (Sigma-Aldrich) and vortexed until the solution was solubilized ...
-
bioRxiv - Developmental Biology 2023Quote: ... we prepared NGM dishes as above and added paraquat (N,N’-dimethyl-4,4’-bipyridium dichloride, 36541, Sigma-Aldrich, Burlington MA) to the molten agar to a final concentration of 40 mM ...
-
bioRxiv - Cancer Biology 2023Quote: ... The samples were then further incubated with 20 µL of N-(tert-butyldimethylsilyl)-N-methyl-trifluoroacetamide with 1% tert-Butyldimethylchlorosilane (TBDMS) (Sigma) at 60 °C for 60 min ...
-
bioRxiv - Neuroscience 2023Quote: ... Adult female SNSiDTR (n=6) and TrkBiDTR (n=19) mice were injected i.p with 40 μg/kg DTX (Sigma, D0564) with a second dose after 72 h ...
-
bioRxiv - Immunology 2023Quote: ... were added followed by dropwise addition of 500 µl 2X BES (50 mM N,N-bis(2hydroxyethyl)-2-aminoethanesulfonic acid (Sigma) + 280 mM NaCl (Sigma ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Dried samples were first resuspended in a 1:1 v/v mixture of a 1% solution of N,N-diisopropylethylamine (Sigma) and a 1% solution of pentaflurobenzylbromine (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: Pharmacological experiments were carried out on PCs during simultaneous somatic and dendritic recordings after 10 minutes of control recording using ACSF with the following drugs: 20 µM 4- (N-ethyl-N-phenylamino)-1,2 dimethyl-6-(methylamino)pyrimidinium chloride (ZD7288) (Sigma-Aldrich), or 1 µM TTX ...
-
bioRxiv - Microbiology 2023Quote: ... expressing mammalian expression vector was generated by subcloning CHPV-N gene from PET-3a-CHPV-N plasmid (gift from Dr. Dhrubajyoti Chattopadhayay) in pFLAG-CMV6a (Sigma). Primers F-5’ TTTATA AAGCTT ATGAGTTCTCAAGTATTC3’ and R-5’ TTTATA GGATCCTCATGCAAAGAGTTTCCT3’ containing the Hind III and BamHI sites respectively were used to amplify CHPV-N gene ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were incubated for 3 hours in serum-free MEM containing 150 µg/mL N-ethyl-N-nitrosourea (ENU) (Sigma). Cells were then maintained in ENU-free medium for 9 days to allow mutations to establish and existing HPRT to degrade ...
-
bioRxiv - Molecular Biology 2023Quote: ... ascending aorta of 10 animals (TBAV: n=5; HTAV: n=5) were incubated in 4,5-diaminofluorescein diacetate (DAF-2DA; Sigma-Aldrich) as previously described20 ...
-
bioRxiv - Cell Biology 2024Quote: ... worms were incubated for 4 hours at 22 °C in 0.5 mM N-nitroso-N-ethylurea (ENU, Sigma Aldrich N3385), washed thoroughly in M9 buffer (22 mM KH2HPO4 ...
-
bioRxiv - Immunology 2024Quote: ... 50 mM of iodoacetamide (BioUltra, Millipore Sigma #I1149) (1 M stock in anhydrous N, N-Dimethylformamide (DMF (Millipore Sigma #227056)) ...
-
bioRxiv - Biophysics 2021Quote: ... n-octylglucoside (OG, Sigma-Aldrich, St. Louis, MO), 3-((3-cholamidopropyl ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 mM N-Acetyl-L-cysteine (Sigma Aldrich) and 10 mM Heregulin Beta-1 (PeproTech).
-
bioRxiv - Cell Biology 2019Quote: For N-Acetyl-L-Cysteine (NAC) (Sigma-Aldrich) treatments we added NAC to the RNAi medium to a final concentration of 8 mM.
-
bioRxiv - Cell Biology 2020Quote: N-Acetyl-L-cysteine (cat# A7250, Sigma-Aldrich)
-
bioRxiv - Developmental Biology 2021Quote: ... 1 μM N-Acetyl-L-cysteine (Sigma-Aldrich). 10 μM Y-27632 was added for the first two days of culture ...
-
bioRxiv - Immunology 2021Quote: ... 0.5% n-Octyl-β-D-glucopyranoside (Merck Millipore). Finally lysates were subjected to chromatin shearing with Qsonica Sonicator Q700 (Thermoscientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... and N-Acetyl-L-cysteine (NAC, Sigma, A7250) enriched diets were prepared by supplementing regular fly food with weight/volume measures of succinate and NAC to achieve 3% and 0.1% concentrations ...
-
bioRxiv - Immunology 2022Quote: ... 1.25 mM N-Acetyl-L-cysteine (Sigma, A9165), 500 nM A83-01 (Tocris ...
-
bioRxiv - Bioengineering 2022Quote: ... and 0.65 g N-hydroxysulfosuccinimide (NHS, Sigma-Aldrich), which was then mixed with another 200 mL ethanol (80% v/v ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 4 mM N-ethylmaleimide (Sigma Cat. E3876) and 4 mM 1,10-phenanthroline (Sigma Cat ...
-
bioRxiv - Biochemistry 2019Quote: ... 2 mg/ml N-acetyl-l-cysteine (Sigma) and ITS liquid media supplement (100x ...
-
Membrane integration and topology of RIFIN and STEVOR proteins of the Plasmodium falciparum parasitebioRxiv - Biochemistry 2019Quote: ... supplemented with N-ethylmaleimide (Sigma-Aldrich Merck, USA) and 1% cOmplete protease inhibitor (Roche ...
-
bioRxiv - Biochemistry 2019Quote: ... 0.1% N-tert-butyloxy-carbomyl-L cysteine (Sigma) and 0.1% O-phthaldehyde ...
-
bioRxiv - Developmental Biology 2019Quote: ... 2.5 mM DSG (Di(N-succinimidyl) glutarate) (Sigma) was added to the fixation buffer containing 1.8% of formaldehyde ...
-
bioRxiv - Biochemistry 2019Quote: ... Samples were treated with N-ethylmaleimide (NEM) (Sigma) at a concentration of 20 mM before further processing ...
-
bioRxiv - Cell Biology 2019Quote: ... N-acetylcysteine (NAC) were obtained from Sigma-Aldrich Chemical Co ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and N-Hydroxysuccinimide (NHS) were procured from Sigma–Aldrich Company (Darmstadt ...
-
bioRxiv - Immunology 2019Quote: ... or 20 μM nigericin (N-7143, Sigma-Aldrich) for 45 min ...
-
bioRxiv - Immunology 2021Quote: ... 2 mM N-Acetyl-L-cysteine (Cysteine; Sigma), 10 mM Zinc sulfate heptahydrate (Zinc ...
-
bioRxiv - Neuroscience 2020Quote: Clozapine-N-oxide (CNO) (Sigma: C0832, Tocris: 4936) prepared in saline was intraperitoneally injected (12 μg/g body weight)64 ...
-
bioRxiv - Bioengineering 2020Quote: ... 1 mM N-Acetylcystine (Sigma Aldrich A9165-5G), 100 μg/ml Primocin (Invivogen ant-pm-1) ...
-
bioRxiv - Bioengineering 2020Quote: ... 10 mM N-acetyl L-Cysteine (Sigma #A9165), and 55 µM 2-mercaptoethanol (Sigma #M3148-100ML ...
-
bioRxiv - Bioengineering 2020Quote: ... 1 mM N-acetyl-L-cysteine (Sigma-Aldrich) in basal culture medium ...
-
bioRxiv - Bioengineering 2019Quote: ... 1.25 mM N-acetylcysteine (Sigma Aldrich A9165-SG) and B27 Supplement (Gibco)] ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.5 μM ascorbic acid (Sigma, Cat N° A4403), and 0.1% β-mercaptoethanol (Cat N° 31350010) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2% N-21 (Cat #SCM081, Millipore Sigma), plated at a density of 5 ganglia per well ...
-
bioRxiv - Neuroscience 2020Quote: ... N-Methyl-D-aspartic acid (NMDA; Sigma-Aldrich) and sodium pentobarbital (Ceva Santé Animale) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and N-Ethylamaleimide (Sigma-Aldrich, St. Louis, MO). The concentration of all proteins was measured using Bio-Rad’s Bradford dye following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 mM N-acetyl-L-cysteine (Sigma Aldrich), 100 ng/mL recombinant murine EGF (PeproTech) ...
-
bioRxiv - Neuroscience 2020Quote: Acrylic acid N-hydroxysuccinimide ester (AAx, Sigma A8060) was prepared by dissolving in N,N-Dimethylformamide to 125 mM ...