Labshake search
Citations for Millipore Sigma :
2001 - 2050 of 4665 citations for SARS Coronavirus Spike Glycoprotein S1 Mosaic N Term E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Dried samples were first resuspended in a 1:1 v/v mixture of a 1% solution of N,N-diisopropylethylamine (Sigma) and a 1% solution of pentaflurobenzylbromine (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: Pharmacological experiments were carried out on PCs during simultaneous somatic and dendritic recordings after 10 minutes of control recording using ACSF with the following drugs: 20 µM 4- (N-ethyl-N-phenylamino)-1,2 dimethyl-6-(methylamino)pyrimidinium chloride (ZD7288) (Sigma-Aldrich), or 1 µM TTX ...
-
bioRxiv - Microbiology 2023Quote: ... expressing mammalian expression vector was generated by subcloning CHPV-N gene from PET-3a-CHPV-N plasmid (gift from Dr. Dhrubajyoti Chattopadhayay) in pFLAG-CMV6a (Sigma). Primers F-5’ TTTATA AAGCTT ATGAGTTCTCAAGTATTC3’ and R-5’ TTTATA GGATCCTCATGCAAAGAGTTTCCT3’ containing the Hind III and BamHI sites respectively were used to amplify CHPV-N gene ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were incubated for 3 hours in serum-free MEM containing 150 µg/mL N-ethyl-N-nitrosourea (ENU) (Sigma). Cells were then maintained in ENU-free medium for 9 days to allow mutations to establish and existing HPRT to degrade ...
-
bioRxiv - Molecular Biology 2023Quote: ... ascending aorta of 10 animals (TBAV: n=5; HTAV: n=5) were incubated in 4,5-diaminofluorescein diacetate (DAF-2DA; Sigma-Aldrich) as previously described20 ...
-
bioRxiv - Genetics 2023Quote: ... Pregnant female mice were given one intraperitoneal (i.p.) injection of 30 mg/kg body weight of the carcinogen N-ethyl-N-nitrosourea (ENU, Sigma N3385) dissolved in phosphate-buffered citric acid (pH 5.8 ...
-
bioRxiv - Biophysics 2021Quote: ... n-octylglucoside (OG, Sigma-Aldrich, St. Louis, MO), 3-((3-cholamidopropyl ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 mM N-Acetyl-L-cysteine (Sigma Aldrich) and 10 mM Heregulin Beta-1 (PeproTech).
-
bioRxiv - Cell Biology 2019Quote: For N-Acetyl-L-Cysteine (NAC) (Sigma-Aldrich) treatments we added NAC to the RNAi medium to a final concentration of 8 mM.
-
bioRxiv - Cell Biology 2020Quote: N-Acetyl-L-cysteine (cat# A7250, Sigma-Aldrich)
-
bioRxiv - Developmental Biology 2021Quote: ... 1 μM N-Acetyl-L-cysteine (Sigma-Aldrich). 10 μM Y-27632 was added for the first two days of culture ...
-
bioRxiv - Immunology 2021Quote: ... 0.5% n-Octyl-β-D-glucopyranoside (Merck Millipore). Finally lysates were subjected to chromatin shearing with Qsonica Sonicator Q700 (Thermoscientific ...
-
bioRxiv - Developmental Biology 2021Quote: ... and N-Acetyl-L-cysteine (NAC, Sigma, A7250) enriched diets were prepared by supplementing regular fly food with weight/volume measures of succinate and NAC to achieve 3% and 0.1% concentrations ...
-
bioRxiv - Immunology 2022Quote: ... 1.25 mM N-Acetyl-L-cysteine (Sigma, A9165), 500 nM A83-01 (Tocris ...
-
bioRxiv - Bioengineering 2022Quote: ... and 0.65 g N-hydroxysulfosuccinimide (NHS, Sigma-Aldrich), which was then mixed with another 200 mL ethanol (80% v/v ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 4 mM N-ethylmaleimide (Sigma Cat. E3876) and 4 mM 1,10-phenanthroline (Sigma Cat ...
-
bioRxiv - Biochemistry 2019Quote: ... 2 mg/ml N-acetyl-l-cysteine (Sigma) and ITS liquid media supplement (100x ...
-
Membrane integration and topology of RIFIN and STEVOR proteins of the Plasmodium falciparum parasitebioRxiv - Biochemistry 2019Quote: ... supplemented with N-ethylmaleimide (Sigma-Aldrich Merck, USA) and 1% cOmplete protease inhibitor (Roche ...
-
bioRxiv - Biochemistry 2019Quote: ... 0.1% N-tert-butyloxy-carbomyl-L cysteine (Sigma) and 0.1% O-phthaldehyde ...
-
bioRxiv - Developmental Biology 2019Quote: ... 2.5 mM DSG (Di(N-succinimidyl) glutarate) (Sigma) was added to the fixation buffer containing 1.8% of formaldehyde ...
-
bioRxiv - Biochemistry 2019Quote: ... Samples were treated with N-ethylmaleimide (NEM) (Sigma) at a concentration of 20 mM before further processing ...
-
bioRxiv - Cell Biology 2019Quote: ... N-acetylcysteine (NAC) were obtained from Sigma-Aldrich Chemical Co ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and N-Hydroxysuccinimide (NHS) were procured from Sigma–Aldrich Company (Darmstadt ...
-
bioRxiv - Immunology 2019Quote: ... or 20 μM nigericin (N-7143, Sigma-Aldrich) for 45 min ...
-
bioRxiv - Immunology 2021Quote: ... 2 mM N-Acetyl-L-cysteine (Cysteine; Sigma), 10 mM Zinc sulfate heptahydrate (Zinc ...
-
bioRxiv - Neuroscience 2020Quote: Clozapine-N-oxide (CNO) (Sigma: C0832, Tocris: 4936) prepared in saline was intraperitoneally injected (12 μg/g body weight)64 ...
-
bioRxiv - Bioengineering 2020Quote: ... 1 mM N-Acetylcystine (Sigma Aldrich A9165-5G), 100 μg/ml Primocin (Invivogen ant-pm-1) ...
-
bioRxiv - Bioengineering 2020Quote: ... 10 mM N-acetyl L-Cysteine (Sigma #A9165), and 55 µM 2-mercaptoethanol (Sigma #M3148-100ML ...
-
bioRxiv - Bioengineering 2020Quote: ... 1 mM N-acetyl-L-cysteine (Sigma-Aldrich) in basal culture medium ...
-
bioRxiv - Bioengineering 2019Quote: ... 1.25 mM N-acetylcysteine (Sigma Aldrich A9165-SG) and B27 Supplement (Gibco)] ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.5 μM ascorbic acid (Sigma, Cat N° A4403), and 0.1% β-mercaptoethanol (Cat N° 31350010) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2% N-21 (Cat #SCM081, Millipore Sigma), plated at a density of 5 ganglia per well ...
-
bioRxiv - Neuroscience 2020Quote: ... N-Methyl-D-aspartic acid (NMDA; Sigma-Aldrich) and sodium pentobarbital (Ceva Santé Animale) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and N-Ethylamaleimide (Sigma-Aldrich, St. Louis, MO). The concentration of all proteins was measured using Bio-Rad’s Bradford dye following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 mM N-acetyl-L-cysteine (Sigma Aldrich), 100 ng/mL recombinant murine EGF (PeproTech) ...
-
bioRxiv - Neuroscience 2020Quote: Acrylic acid N-hydroxysuccinimide ester (AAx, Sigma A8060) was prepared by dissolving in N,N-Dimethylformamide to 125 mM ...
-
bioRxiv - Bioengineering 2021Quote: ... Monomers N-(3-methoxypropyl)acrylamide (MPAM; Sigma, 95%), 4-acryloylmorpholine (MORPH ...
-
Intra-mitochondrial proteostasis is directly coupled to alpha-synuclein and Amyloid β 1-42 pathologybioRxiv - Neuroscience 2020Quote: ... N-Methyl-4-phenylpyridinium Iodide (MPP+, Sigma-Aldrich) 10 mM in water ...
-
bioRxiv - Cell Biology 2021Quote: ... N-ethylmaleimide and DTT were obtained from Sigma. Tris(2-carboxyethyl ...
-
bioRxiv - Cell Biology 2021Quote: ... N-Acetyl-L-cysteine (1,25 mM, Sigma #A9165), Nicotinamide (5 mM ...
-
bioRxiv - Microbiology 2020Quote: ... n-Dodecyl β-D-maltoside (DDM, D4641, Sigma), at a final concentration of 0.1% was used to lyse the virus.
-
bioRxiv - Microbiology 2020Quote: ... 20 μM N-acetyl cysteine (Nac, Sigma-Aldrich) was added ...
-
bioRxiv - Microbiology 2020Quote: ... N-acetyl-glucosamine (NAG, Sigma, Cat. No. A3286) was added to the culture to a final concentration of 50 mM from day 6 to day 11 of the culture ...
-
bioRxiv - Bioengineering 2021Quote: ... and N-methyl-2-pyrrolidone (NMP, Sigma-Aldrich) at a 1:1 volume ratio was used with the pneumatic atomiser and a tip size of 300 μm ...
-
bioRxiv - Cell Biology 2021Quote: ... Sigma) in 40% N-methylacetamide (Sigma-Aldrich #M26305) in PBS ...
-
bioRxiv - Biophysics 2020Quote: ... NEM (N-Ethylmaleimide, Sigma-Aldrich, St. Louis, MO); DTT (dithiothreitol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... BIO 14μM (cat n° B1686, Sigma-Aldrich Merck) and SB505124 30μM (cat n° S4696 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... BIO 1μM (cat n° B1686, Sigma-Aldrich Merck) and SB505124 50μM (cat n° S4696 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... SU5402 20μM (cat n° SML0444, Sigma-Aldrich Merck), BIO 14μM (cat n° B1686 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1.25 mM N-acetylcysteine (Sigma-Aldrich #A9165-5G), 50 ng/mL EGF (Invitrogen #PMG8043) ...