Labshake search
Citations for Millipore Sigma :
2101 - 2150 of 10000+ citations for Human Dual Specificity Phosphatase 3 DUSP3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: Human serum (Sigma-Aldrich, H4522) was thawed on ice and centrifuged at 18,000 ×g for 10 min at 4 °C to remove lipids ...
-
bioRxiv - Immunology 2024Quote: ... 10% human serum (Sigma-Aldrich), 100 U/ml Penicillin (Cellgro Technologies LLC) ...
-
bioRxiv - Bioengineering 2024Quote: ... Human thrombin (Sigma, #T6884-100UN) was reconstituted in sterile 0.9% saline supplemented with human serum albumin (0.1% w/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... thrombin (from human plasma, Sigma) and aprotinin (from bovine lung ...
-
bioRxiv - Immunology 2024Quote: ... 5% human AB serum (Sigma), 500 IU/mL of IL-2 (Proleukin S ...
-
bioRxiv - Molecular Biology 2021Quote: Human genomic DNA was isolated from HeLa cells using a GenElute™ Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich). Target genes were PCR amplified from genomic DNA using Phusion® High-Fidelity DNA Polymerase (NEB ...
-
Activation of innate immune cGAS-STING pathway contributes to Alzheimer’s pathogenesis in 5×FAD micebioRxiv - Neuroscience 2022Quote: Binding of cGAS and dsDNA in human and mouse brain sections was determined by PLA kit (DUO92101, Sigma-Aldrich) accordingly to the manufacture’s instruction ...
-
bioRxiv - Cell Biology 2023Quote: ... Cytokine analysis was performed by Cincinnati Children’s Hospital Research Flow Cytometry Core per kit instructions (Milliplex MAP human protein panel, Millipore-Sigma).
-
bioRxiv - Neuroscience 2024Quote: ... The proximity ligation reaction and visualization of signal was performed according to the manufacturer’s protocol using the Duolink Detection Kit with PLA PLUS and MINUS probes for rabbit and human antibodies (Sigma). DAPI stain was used to detect cell nuclei ...
-
bioRxiv - Immunology 2021Quote: ... ELISA plates were coated with the capturing reagent in PBS [OVA (Sigma, A5503) for antigen ELISAs ...
-
bioRxiv - Microbiology 2021Quote: ... 5′5′-Tetramethylbenzidine (TMB) Liquid Substrate System for ELISA (Sigma-Aldrich, Taufkirchen, Germany) was added until a colour change was observed ...
-
bioRxiv - Pathology 2019Quote: ... BR) and insulin Elisa assay (cat#EZRMI-13K, Merck Millipore, Billerica, MA, EUA) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Overnight fasting serum levels were quantified by ELISA for insulin (#EZRMI-13K; Millipore) and leptin (#90030 ...
-
bioRxiv - Genetics 2020Quote: ... Cell lines were tested for mycoplasma contamination using the Mycoplasma PCR ELISA (Sigma).
-
bioRxiv - Molecular Biology 2024Quote: ... Plasma insulin was measured by enzyme-linked immunosorbent assay (ELISA) (Millipore, Burlington MA).
-
bioRxiv - Physiology 2024Quote: ... Plasma active (acylated) ghrelin was measured by mouse/rat ELISA (EZRGRA-90K, Millipore). Plasma total ghrelin was measured by mouse/rat ELISA (EZRGRT-91K ...
-
bioRxiv - Immunology 2024Quote: ... 96-well ELISA plates were first coated overnight with poly-L-lysine (Sigma), then overnight with DNA from calf thymus (Sigma ...
-
bioRxiv - Microbiology 2023Quote: Costar 96-well ELISA plates were coated with 10 μg of fibronectin (Sigma) for the fibronectin-binding assay and 10 μg of fibrinogen (Sigma ...
-
bioRxiv - Physiology 2023Quote: ... and plasma insulin (n=5) was analyzed by ELISA (EZRMI-13K, Sigma Aldrich), according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2019Quote: Transmembrane permeability of confluent HBMEC was analysed in a dual-chamber system (0.4 µM pore size; Millipore). HBMEC were treated with normal serum or patient serum (diluted 1:1 with PBS ...
-
bioRxiv - Genomics 2021Quote: Dual OPAL immunofluorescent labeling with SCA5E12 and anti-CD45 antibodies (catalog# 145M-94, Cell Marque/Sigma Aldrich), was performed on formalin-fixed ...
-
bioRxiv - Immunology 2020Quote: ... two STAT-3 inhibitors (STAT-3 inhibitor III (WP-1066) and STAT-3 inhibitor XIII (C-188-9) were tested (Merck, Sigma) and WP-1066 was used for infection studies at a final concentration of 12 μM ...
-
bioRxiv - Cancer Biology 2019Quote: ... ADORA1 selective and competitive antagonists 1-Butyl-3-(3-hydroxypropyl)-8-(3-noradamantyl) xanthine (PSB36) and 8-cyclopentyl-1,3-dipropylxanthine (DPCPX) (Sigma-Aldrich); ADORA2b selective antagonist 4-(2,3,6,7-Tetrahydro-2 ...
-
bioRxiv - Plant Biology 2020Quote: ... inflorescences were soaked in 3% (w/v) 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (Sigma Chemical, St. Louis, MO, USA, E6383) with 0.05% (v/v ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2–3 endodermal explants (2PP or 3/4PP endoderm) were combined with 2–3 mesenchymal explants on Nucleopore membrane filters (Millipore) supported by fine meshed metal grids (Goodfellows) ...
-
bioRxiv - Molecular Biology 2022Quote: Cell growth was monitored by cell counting and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay using MTT cell growth assay kit (#CT02, Millipore). FL or ΔN-Drosha cells (1×105 ...
-
bioRxiv - Neuroscience 2022Quote: ... or MG132 using a MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium-based in vitro toxicology kit (TOX1-1KT, Sigma). 10 µl MTT solution was applied to cells at the end point of the experiment and incubated for 4 hours ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2020Quote: ... 14-3-3 antibody and active recombinant AMPK (α2β1γ1) were from Millipore. Precast Tris-Glycine polyacrylamide gels and 10X tris-glycine gel electrophoresis buffer were from BioRad ...
-
bioRxiv - Bioengineering 2021Quote: ... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC-HCl, Sigma Aldrich, 8510070025), chlorosulfonic acid (Sigma 571024) ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... in the presence of 1 mM 3-aminotriazol (3-AT) (Sigma-Aldrich). Results were expressed in the form of a heat map for the strength of interaction according to the colony growth after five days of incubation at 30°C.
-
bioRxiv - Neuroscience 2021Quote: ... and developed using 3-3’-diaminobenzidine (DAB; Sigma-Aldrich, St. Louis, MO) as the chromogen.
-
bioRxiv - Microbiology 2021Quote: ... N-(3-oxododecanoyl)-l-homoserine lactone (3-oxo-C12-HSL, Millipore Sigma); and a rhamnolipid mixture (RHL ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μM (2’Z,3’E)-6-Bromoindirubin-3’-oxime (Sigma, B1686), 20 μM Tideglusib (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Bioengineering 2021Quote: ... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 7.00 g; Sigma) (molar ratio of NHS:EDC = 1:2 ...
-
bioRxiv - Immunology 2024Quote: ... HRP activity was detected with SIGMAFAST 3-3’Diaminobenzidine tablets (Sigma-Aldrich), whereas alkaline-phosphatase activity was detected using naphtol AS-MX phosphate and fast blue salt with levamisole (All from Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2023Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC-HCl; Sigma-aldrich) were added at a concentration of 0.47 and 0.95 mg mL-1 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... then 0.2 mmol 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) (Sigma, USA) and 0.2 mmol N-Hydroxy succinimide (NHS ...
-
bioRxiv - Bioengineering 2024Quote: ... followed by 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC; Sigma-Aldrich) were added drop-wise at 5000 molar equivalents to the alginate solution while stirring ...
-
bioRxiv - Neuroscience 2024Quote: ... a 3 mm-thick agar gel cap (Sigma, 3% in distilled water) was placed between the head and the surface coil ...
-
bioRxiv - Neuroscience 2024Quote: ... The two odors used were 3-octanol (3-Oct) (Sigma-Aldrich 218405) and 4-methyl-cyclohexanol (MCH ...
-
bioRxiv - Pathology 2020Quote: ... high-purity (>99%) human CRP obtained from human plasma (C4063; Sigma-Aldrich, Saint Louis, Missouri) was infused via the femoral vein after 45 minutes of ischemia with LAD ligation ...
-
bioRxiv - Biophysics 2020Quote: ... Human Serum from human male AB plasma and NaOH 1N Bioreagent were purchased from Sigma. ss M13mp18 ...
-
bioRxiv - Immunology 2023Quote: ... Human platelets were stimulated with 1 U ml−1 Thrombin from human plasma (Sigma-Aldrich) or left unstimulated for 30 min to assess the purity and activation of isolated cells ...
-
bioRxiv - Biochemistry 2024Quote: ... and human apo-transferrin (P02787) isolated from human plasma were purchased from Sigma Aldrich (E0518), Invitrogen (RP-43132) ...
-
bioRxiv - Biophysics 2019Quote: ... 3 μL benzonase (Novagen) and sonicated ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 μM CHIR99021 (Sigma), 1 μM PD0325901 (Sigma) ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 % donkey serum (Millipore) and 0.5 % Triton X-100 in PBS at RT for 3 h ...