Labshake search
Citations for Millipore Sigma :
2101 - 2150 of 10000+ citations for 6 Hydroxy 2 4 5 triaminopyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Brdu-ChIP was performed after addition of 20 μM BrdU (5-bromo-2′-deoxyuridine, Sigma Aldrich) directly to HeLa culture medium for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... for 3.5 minutes at 5 μL/min with 2% Acetonitrile MS grade (Sigma Aldrich, Cat# 1207802), 0.1% formic acid (FA ...
-
bioRxiv - Microbiology 2020Quote: ... For this, NHS-CF555 (5 µl, 2 mM) in dimethyl sulfoxide (DMSO; Sigma-Aldrich Co., LLC) was added to AgNP (500 µl) ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Neuroscience 2021Quote: ... mouse α-tubulin clone B-5-1-2 (1:1000; Sigma Aldrich, San Luis, MO, U.S.). For immunofluorescence primary antibodies were labeled with Alexa-conjugated secondary antibodies Alexa 488 ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 -5 mg of MeHA was dissolved in 1 mL Deuterium oxide (D2O) (Sigma Aldrich, 151882) and then tested with 300MHz 1HNMR with 10 ms time scale ...
-
bioRxiv - Microbiology 2020Quote: ... Senescence was induced by treating cells with 100 µM 5-Bromo-2’-deoxyuridine (Sigma Aldrich, USA) for 48 hours ...
-
bioRxiv - Systems Biology 2021Quote: ... the proteins the samples were reduced with 5 mM Tris(2-carboxyethyl)phosphine (TCEP; Sigma-Aldrich) for 20 minutes in 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 µM of 5’heyxynyl-dT50 (IDT) were mixed with 2 mM of CuSO4 (SIGMA, C1297) and DDW ...
-
bioRxiv - Microbiology 2022Quote: ... Blocking was performed at room temperature for 2 hours using 5% skimmed milk (70166, Sigma-Aldrich) in 1X PBS containing 0.05% Tween 20 (P1379 ...
-
bioRxiv - Immunology 2022Quote: Neonatal and juvenile mice received daily intraperitoneal injections of 5-aza-2’-deoxycytidine (decitabine, DAC; Sigma) 1 mg/kg (7 ...
-
bioRxiv - Microbiology 2019Quote: ... These bands were first reduced with 5 mM Tris (2-carboxyethyl) phosphine hydrochloride (TCEP; Sigma-Aldrich) followed by alkylation with 50 mM iodoacetamide and digested with 1μg trypsin for as long as 16 hours at 37 °C ...
-
bioRxiv - Cancer Biology 2019Quote: ... AGS and HUH7 cells pulsed with 10 µM 5-bromo-2′-deoxyuridine (BrdU) (B5002; Sigma-Aldrich) were stained with propidium iodide (P4864 ...
-
bioRxiv - Genetics 2020Quote: ... Animals were then placed on NGM plates containing 10 µM 5-Fluoro-2′-deoxyuridine (FUDR, Sigma) to inhibit the development of progeny ...
-
bioRxiv - Cell Biology 2021Quote: ... worms were subsequently mounted on 2% agarose pads and anesthetized with 5 mM tetramisole (Sigma-Aldrich) for observation under a fluorescence microscope.
-
bioRxiv - Immunology 2020Quote: Mice were injected intraperitoneally with 0.5 mg 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen or Sigma-Aldrich). For pulse experiments ...
-
bioRxiv - Microbiology 2021Quote: ... MNZ (5 uM for 24 hrs) or GSNO (350 μM for 2 hrs) (Sigma-Aldrich, USA) was determined by the eosin dye exclusion method [31].
-
bioRxiv - Molecular Biology 2022Quote: ... Ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′-tetraacetic acid (EGTA) 5 mM (Sigma E3889) was added to quench the reaction ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli were also grown in 2 mL Overnight Express Instant TB media (Sigma Aldrich, 71491-5) with added 100 μg/mL ampicillin ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Cell Biology 2023Quote: ... RPMI media containing 5% FBS and 2% w/v bovine serum albumin (BSA; Sigma-Aldrich #A6003). FA mixtures were gently rocked for 1 hour at 37°C to aid conjugation of the fatty acids to BSA ...
-
bioRxiv - Molecular Biology 2023Quote: ... Exponentially growing RPE-1 cells were pulse-labeled with CldU (5-Chloro-2’-deoxyuridine, Millipore Sigma) and IdU (5-Iodo-2’-deoxyuridine ...
-
bioRxiv - Neuroscience 2023Quote: ... Dissociated cells were treated with 1 μM of 5-fluoro-2′-deoxyuridine (Sigma, cat. no. F0503) for the first 24 hours to remove presumptive progenitor and/or glial cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 mL of the single cell suspension was then overlayed on 2 mL 30 % Percoll (Sigma) and centrifuged with disabled break at 600g for 8 minutes at 4 °C ...
-
bioRxiv - Bioengineering 2022Quote: ... cells were incubated for 2 h at 37 °C and 5% CO2 with MTT (Sigma-Aldrich) dissolved in DMEM media without phenol red ...
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Developmental Biology 2023Quote: ... ESCs were pulsed for 24 h with 0.1 µM 5-ethynyl-2’-deoxyuridine (EdU; T511285, Sigma), in parallel to doxycycline treatment ...
-
bioRxiv - Molecular Biology 2023Quote: ... Exponentially growing RPE-1 cells were pulse-labeled with CldU (5-Chloro-2’-deoxyuridine, Millipore Sigma) and IdU (5-Iodo-2’-deoxyuridine ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 5 min and blocked with PBS containing 2% FBS and 0.05% Tween20 (Sigma Aldrich, France) for 1h ...
-
bioRxiv - Cell Biology 2023Quote: ... Bottom coverslips are activated with a 2% 3-Aminopropyltrimethoxysilane (3-APTMS) (Sigma Aldrich 13822-56-5) in 96% ethanol solution for 5 minutes and washed with 70% ethanol ...
-
bioRxiv - Molecular Biology 2023Quote: ... supplemented with 1:10000 dilution of anti-mouse alpha-Tubulin (Clone B-5-1-2; SIGMA) for 1 to 3 h at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... inactive dephosphorylated A3 (2’,5’-A3) 53 or with poly(I):poly(C) (Millipore Sigma, #528906) at the concentrations indicated in figure legends with Lipofectamine 2000 (Invivogen ...
-
bioRxiv - Biophysics 2023Quote: ... and anti-alpha tubulin primary antibodies (monoclonal mouse clones B-5-1-2 and DM1a, Sigma), revealed with donkey anti-mouse secondary antibodies conjugated to Alexa Fluor 555 ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected 5-bromo-2′-deoxyuridine (BrdU, 10 mg/ml in saline, 100 mg/kg, Sigma) through an intraperitoneal (i.p. ...
-
bioRxiv - Immunology 2023Quote: ... after treatment for 2 h at 37°C with 5 μg/ml brefeldin A (Sigma-Aldrich). Cells were washed and fixed with BD cell fix diluted 4X in PBS ...
-
bioRxiv - Microbiology 2023Quote: ... the parasites were selected with 10 μM 5-fluoro-2-deoxyuridine (FUDR) (Sigma–Aldrich, Cat#F0503) for three passages ...
-
bioRxiv - Microbiology 2023Quote: ... 120mM Tris HCl pH=6.8 and 20% glycerol(v/v)) containing 5% 2-mercaptoethanol (Sigma-Aldrich). Samples were resolved on a 10% SDS-PAGE gel in 1 × Tris glycine SDS buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mouse monoclonal anti α-tubulin clone B-5-1-2 (Sigma-Aldrich, St. Louis, MO, USA) and anti-PABP [49] were used as loading controls ...
-
bioRxiv - Microbiology 2024Quote: ... 3-(2pyridyl)-5,6-bis(2-(5-furylsulfonic acid))-1,2,4-triazin (Sigma-Aldrich, St Louis, MO, USA) (27) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg/mL 5-fluoro-2′-deoxyuridine + 7 μg/mL uridine (FRDU, F0503, Sigma-Aldrich). Cultured cells were then kept at 37°C and 5% CO2 in an incubator with culture media changes at 48 hours with supplemented media and NGF and FRDU until further experimentation.
-
bioRxiv - Neuroscience 2024Quote: A mix of endotoxin-free plasmid preparation (2-5 mg/mL) and 0.5% Fast Green (Sigma) mixture was injected using a Picospritzer III (Parker ...
-
bioRxiv - Cancer Biology 2022Quote: ... SNB19 and BTSC 233 cells were treated with 10 mM 4-methylthio-2-oxobutyric acid (MTOB, Sigma) for 24h ...
-
bioRxiv - Neuroscience 2021Quote: ... ablation efficiency was confirmed using the fluorescent dye 2-4-(dimethylamino)styryl-N-ethylpyridinium-iodide (DASPEI)(Sigma). Larvae were immersed in 0.005% DASPEI in E3 for 15 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... Tubïgen larva from each treatment group were incubated in 4ug/ml Diasp (2-Di-4-Asp, Sigma) and 0.3 ug/ml DioC6 (3,3-dihexyloxacarbocyanine iodide ...
-
bioRxiv - Developmental Biology 2020Quote: ... larval sections were counterstained with DAPI (4′,6diamidino-2-phenylindole, Sigma-Aldrich; 1:1000 μL PBS dilution) and incubated for 15 min in the dark at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then treated with 2 mM (or 4 mM for HCoV 229E) bromouridine (BrU; Sigma Aldrich) and 15 μM actinomycin D (ActD ...
-
bioRxiv - Plant Biology 2022Quote: ... they were supplemented once per week with 1/4 strength Hoagland No.2 media (Sigma Aldrich H2395). For tissue harvesting ...
-
bioRxiv - Biochemistry 2022Quote: ... and trans-4-Phenyl-3-buten-2-one (20a) were purchased from Sigma-Aldrich (St. Louis, MO). Ketoisophorone (2a ...
-
bioRxiv - Pathology 2019Quote: ... a cell-permeant NO scavenger 2-(4-car-boxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide (cPTIO) (Sigma) at a high concentration of 500 μM was included ...
-
bioRxiv - Genetics 2020Quote: ... Intestinal organoids were induced on day 2 after splitting using 800 nM 4-OH tamoxifen (Sigma H7904) for 24 h.