Labshake search
Citations for Millipore Sigma :
1951 - 2000 of 10000+ citations for Mouse Marginal Zone B And B1 Cell Specific Protein MZB1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... The Cell Proliferation Kit II XTT (Sigma) was used according to the manufacturer ...
-
bioRxiv - Immunology 2023Quote: ... Cell proliferation kit (MTT) by Millipore Sigma was used to assess cell proliferation ...
-
bioRxiv - Cancer Biology 2021Quote: ... The cells were incubated with anti-GM130 antibody (clone 4A3 Millipore, Mouse), or calnexin (mouse mAb ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were incubated with anti-Flag M2 mouse monoclonal antibody (Sigma-Aldrich) diluted 1:400 in blocking solution for 1 h to detect SRVB/A reporters ...
-
bioRxiv - Microbiology 2021Quote: ... Fixed cells were incubated with primary mouse monoclonal anti-FLAG M2 (Sigma) and rabbit polyclonal anti-S ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were exposed to 1:1,000 mouse antitubulin antibody (T6O74, Sigma-Aldrich) overnight at 4°C ...
-
bioRxiv - Immunology 2020Quote: ... cells were primed with 100 U/ml of mouse IFNγ (EMD Millipore) overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... Proliferative cells were stained with mouse α-BrdU antibody (Sigma Aldrich, B8434). Donkey Alexa fluor secondary antibodies were used ...
-
bioRxiv - Bioengineering 2019Quote: A mouse chondrogenic cell line (ATDC-5, derived from teratocarcinoma AT805, Sigma) and a primary human lung fibroblast cell line (FB ...
-
bioRxiv - Neuroscience 2020Quote: ... the cells were incubated overnight with mouse anti-GFP antibody (Millipore, #MAB3580), anti-Bassoon antibody (SySy ...
-
bioRxiv - Biophysics 2021Quote: ... the expressed cells were incubated with mouse anti-HA-FITC antibody (Sigma) for 20 min at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ATDC5 cells (mouse 129 teratocarcinoma-derived osteochondral progenitors; cat# 99072806, Sigma-Aldrich)
-
bioRxiv - Cell Biology 2020Quote: MC3T3-E1 cells (mouse C57BL/6 calvarial fibroblasts; cat# 99072810, Sigma-Aldrich)
-
bioRxiv - Biophysics 2020Quote: ... Cells were sensitized with mouse monoclonal anti- 2,4-dinitrophenyl IgE (Sigma-Aldrich) at 0.5 μg ml−1 overnight and stimulated with 80 ng ml−1 multivalent antigen ...
-
bioRxiv - Neuroscience 2022Quote: ... Blocked cells were incubated with Flag M2 (raised in mouse, Sigma-Aldrich Cat# F1804 ...
-
bioRxiv - Immunology 2022Quote: ... pneumoniae was determined using mouse atrial cardiomyocytes (HL-1) cells (Millipore Sigma). HL-1 cells HL-1 cells were passaged and grown in Claycomb media (Sigma ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were incubated with mouse anti-CSPG antibody (#c8053; Sigma-Aldrich, USA) diluted 1:50 in MACS® BSA Stock Solution and autoMACS® Rinsing Solution (1:20 ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were then incubated with a mouse antibody M2 (Sigma-Aldrich, F1804) diluted in PBS/1% BSA for one hour at 37°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were incubated with mouse anti-CSPG antibody (#c8053; Sigma-Aldrich, USA) diluted 1:50 in MACS® BSA Stock Solution and autoMACS® Rinsing Solution (1:20 ...
-
bioRxiv - Microbiology 2023Quote: ... the cells were incubated with a mouse antibody M2 (Sigma-Aldrich, F1804) diluted in PBS/1% BSA for one hour at 37℃ ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were incubated with mouse anti-α-actinin (Sigma, A7732, 1:1000) and rabbit anti-Ki67 (Cell Signaling ...
-
bioRxiv - Molecular Biology 2024Quote: HL-1 mouse cardiomyocyte cell line was procured from Millipore (Cat. # SCC065), and grown as indicated by the supplier ...
-
bioRxiv - Cancer Biology 2023Quote: H1299 (a human non-small cell lung carcinoma cell line) and B16 (a mouse skin melanoma cell line) cells were cultured in RPMI1640 (Sigma-Aldrich., St. Louis, MO) supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Immunology 2023Quote: ... Antibody-stained cells were subsequently probed with Duolink In Situ PLA Probe anti-mouse PLUS and anti-mouse MINUS probes (Sigma/Merck). Next ...
-
bioRxiv - Cell Biology 2020Quote: ... Normal mouse/rabbit IgG or RNA Polymerase II antibodies (provided by Millipore ChIP kit) were used as negative or positive control ...
-
bioRxiv - Biochemistry 2020Quote: ... The mAbs were isotyped using a mouse mAb isotyping test kit (Sigma-Aldrich, USA). The icELISA described above was used to evaluate the affinity (Ka ...
-
bioRxiv - Molecular Biology 2021Quote: ... Serum TSH was analyzed with a mouse pituitary magnetic bead panel kit (EMD Millipore Corp. ...
-
bioRxiv - Cancer Biology 2021Quote: PLA experiments were performed using the Red Mouse/Rabbit Duolink Starter Kit (Sigma-Aldrich) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: The Duolink In Situ Red Starter Mouse/Rabbit kit was from Sigma (#Cat DUO92101) and used according to the manufacturer’s protocol with primary antibodies to Orai1 (mouse 1:500 ...
-
bioRxiv - Neuroscience 2022Quote: ... and TNF-α were measured simultaneously using the multiplexed kit “Mouse High Sensitivity T Cell Magnetic Bead Panel” (MHSTCMAG-70K, MILLIPLEX, EMD Millipore Corp., Billerica, MA, USA). The assay was performed according to the manufacturer’s instructions with an overnight incubation step (17 hours ...
-
bioRxiv - Systems Biology 2022Quote: The proteins were extracted from the frozen cell pellets by lysing the cells with 1% SDC (Sigma, D6750) in HNN Buffe pH 7.8 (50 mM HEPES ...
-
bioRxiv - Microbiology 2020Quote: ... and b (chl b) were identified (RT and maxima absorption spectra) by direct injection of chl a and chl b standards (Sigma-Aldrich C-5753 and 00538, respectively) under the same HPLC conditions ...
-
bioRxiv - Cancer Biology 2022Quote: Western blotting of nuclear extracts or whole cell extracts was performed by standard methods using antibodies specific for the N-terminal portion of ETV6 (Sigma, # HPA000264; Santa Cruz, #sc-166835x), CTCF (Cell Signaling ...
-
bioRxiv - Immunology 2021Quote: ... and 2-mercaptoethanol at 37 °C with 5% CO2. Subsequent to isolation B cells were stimulated with 10 μg/ml lipopolysaccharide (LPS) (Catalog no. L2887) from Sigma-Aldrich (Oakville, ON). For co-culture with MSCs ...
-
bioRxiv - Immunology 2021Quote: ... Subsequent to isolation B cells were stimulated or not with 10 µg/ml LPS (Catalog no. L2887) obtained from Sigma-Aldrich (Oakville, ON). Unless otherwise indicated ...
-
bioRxiv - Immunology 2022Quote: ... Imiquimod-stimulated B cells were treated simultaneously with or without the XBP1 inhibitor 4μ8c [24] (20 μM, Sigma-Aldrich, St. Louis, Missouri, USA) dissolved in DMSO (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... Activation of primary B-cells was induced by the addition of 10 μg/ml LPS (from E. coli, O111:B4, Sigma-Aldrich, Cat#L4391). Ramos cells were authenticated by Eurofins Genomics (Ebersberg ...
-
bioRxiv - Genomics 2023Quote: ... used for spike-in controls for ChIPs of TWIST1 depletions were cultured in Complete ES Cell Medium with 15% FBS (Millipore, ES-101-B), 25 ng/ml bFGF ...
-
bioRxiv - Developmental Biology 2021Quote: ... The non-specific binding of antibodies was blocked with 3% BSA (Sigma-Aldrich) for 45 min at room temperature ...
-
bioRxiv - Plant Biology 2019Quote: ... specific inhibitory compounds treatments were defined: (i) Diphenyleneiodonium (DPI) 10 μM (Sigma, USA) + ABA (20 µM) ...
-
bioRxiv - Genomics 2019Quote: ... After incubation with a primary antibody specific for H3K27me3 (Upstate/Millipore, #07-449), H2AK119ubi (Cell Signaling #8240S) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and a DNA probe specific to tRNAPhe ([Btn]AAATGGTGCGAATTCTGTGGATCGAACACAGGACCTCCAGATCTTC, Sigma-Aldrich, Munich, Germany) as previously reported (67).
-
bioRxiv - Genomics 2020Quote: ... a specific FAM digital PCR assay was designed (Sigma-Aldrich, Gillingham, Dorset, UK) targeting the promotor region of RASSF1A and five 5’-CGCG-3’ BstUI recognition sequences ...
-
bioRxiv - Neuroscience 2020Quote: ... the αAPF antibody diluted 1:1000 or the fiber-specific OC antibody (Millipore) diluted 1:1000 in 5% non-fat milk in TBS-T ...
-
bioRxiv - Neuroscience 2020Quote: ... Plates were incubated with anti-human Fab specific-HRP conjugated secondary antibody (Sigma) for 1 h at RT ...
-
bioRxiv - Genomics 2021Quote: ... Membranes were incubated with specific primary antibodies against: phospho-Ser52-eIF2α (SAB4300221 Sigma), eIF2α (SAB4500729 Sigma) ...
-
bioRxiv - Microbiology 2020Quote: ... the following fragments were amplified using specific primers and cloned in pET24a (Novagen) using the NdeI/XhoI restrictions sites ...
-
bioRxiv - Cancer Biology 2022Quote: Western blot analysis used specific antibodies against β-actin (Sigma Aldrich, St. Louis) and ERα (F10 ...
-
bioRxiv - Neuroscience 2022Quote: ... 400nM of each gene specific primer HPLC purified (Sigma-Aldrich, St. Louis, MO) in 25 μL reaction volume ...
-
bioRxiv - Neuroscience 2020Quote: ... Specific primer pairs were commercially synthesized (Sigma-Aldrich/Merck, Germany; see Table 1). qPCR assays were performed in triplicate reactions using the PowerUp™ SYBR™ Green Master Mix (2X ...