Labshake search
Citations for Millipore Sigma :
1951 - 2000 of 10000+ citations for Estrone 3 Sulfate E1S ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... The transformants were then plated onto MacConkey lactose agar containing 100 μg/ml ampicillin and 100 mM of iron sulfate (FeSO4) (Sigma). After 18 h of incubation at 37°C ...
-
bioRxiv - Microbiology 2021Quote: Samples containing equal amounts of protein were separated using sodium dodecyl sulfate (SDS)-PAGE and then transferred to polyvinylidene difluoride (PVDF) membranes (Millipore). After blocking with 5% skim milk in TBST for 2 h ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... were transferred to individual wells of a 96-well microtiter plate containing 100 µL of M9 buffer (without bacterial food) containing 10 mg/mL serotonin (5-hydroxytryptamine creatinine sulfate complex, Sigma). Egg-laying rates were measured by counting the number of eggs laid after three hours in the presence or absence of serotonin at 20°C (Fig ...
-
bioRxiv - Cancer Biology 2022Quote: Cell extract was prepared by lysing cells in sodium dodecyl sulfate (SDS) sample buffer followed by incubation with benzonase (70746, Millipore) on ice for 10 minutes ...
-
bioRxiv - Developmental Biology 2022Quote: ... separated on 15% sodium dodecyl sulfate-polyacrylamide electrophoresis gels and transferred to a polyvinylidene difluoride membrane (Immobilon-P Transfer membrane, Millipore) by wet blotting in transfer buffer (25 mM Tris– HCl ...
-
bioRxiv - Developmental Biology 2022Quote: ... A few hours later the cells were infected with titer-adjusted volumes of each viral supernatant supplemented with 6 μg/ml (final concentration) of protamine sulfate (Sigma). After two days ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were separated by 8–15% sodium dodecyl sulfate-polyacrylamide gels and transferred to a PVDF membrane (IPVH00010 Millipore Immobilon). After transfer ...
-
bioRxiv - Genetics 2022Quote: ... Equal amounts of protein (40 µg) were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred onto Immobilon-P membranes (Millipore), as previously described (Nakamori et al. ...
-
bioRxiv - Immunology 2022Quote: ... resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) with Laemmli running buffer and transferred to PVDF membranes (Merck-Millipore) in a Trans-Blot® SD Semi-Dry Transfer Cell (Bio-Rad) ...
-
bioRxiv - Neuroscience 2022Quote: ... Currents of 5-HT3A receptors and engineered constructs expressed at the cell surface were evoked by applying 10 μM serotonin creatinine sulfate complex (Sigma), or in short 5-HT ...
-
bioRxiv - Physiology 2022Quote: ... Fixed tissues were then rinsed in PBS followed by immersion in 0.1 mg/ml aqueous Nile Blue sulfate (Sigma-Aldrich) for 30 min ...
-
bioRxiv - Immunology 2022Quote: ... The next day concentrated barcoded lentiviral vector was added at a multiplicity of infection of 25 in the presence of 4 μg/mL protamine sulfate (Sigma). 24 hr following addition of the vector library ...
-
bioRxiv - Biochemistry 2023Quote: The reaction was performed with 5 pmol of folded UTR26 incubated with 0.077% v/v DMS (dimethyl sulfate, Sigma-Aldrich) dissolved in 100% ethanol at 37 °C for 10 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein extracts (40 μg) were separated via electrophoresis on 10% sodium dodecyl-sulfate-polyacrylamide gels and transferred to polyvinylidene difluoride membranes (Millipore). Membranes were blocked in 2% milk-phosphate-buffered saline (PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a polyvinylidene difluoride (PVDF) membrane (IPVH00010, Millipore) using the Trans-Blot Turbo Transfer System (BioRad ...
-
bioRxiv - Cancer Biology 2023Quote: ... Viruses were titered and then used to transduce cells supplemented with 8 µg/ml protamine sulfate (Sigma-Aldrich, USA #P3369).
-
bioRxiv - Cell Biology 2023Quote: ... and transduced the next day with barcode-containing LV at a multiplicity of infection (MOI) of 25 in the presence of 4 mg/ml protamine sulfate (Sigma) (28) ...
-
bioRxiv - Microbiology 2023Quote: ... Protein samples were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) followed by transfer to PVDF membrane (Millipore). The membrane was blocked with 5 % skim milk in tris-buffered saline with 0.1% Tween20 (TBS-T ...
-
bioRxiv - Microbiology 2023Quote: ... Protein extracts were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and electrophoretically transferred to nitrocellulose membranes (Millipore), and blocked in 5% nonfat dry milk ...
-
bioRxiv - Cell Biology 2023Quote: Proteins were separated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a polyvinylidene difluoride (PVDF) membrane (Immobilon, MILLIPORE). Membranes were blocked with 5% nonfat dry milk in PBS with 0.05% Tween20 (PBS-T ...
-
bioRxiv - Cancer Biology 2023Quote: ... Whole cell extracts were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to polyvinylidene difluoride membranes (Millipore #IPVH00010). The antibodies and dilutions used were as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... The samples were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride membrane (PVDF Transfer Membrane, Merck-Millipore). The primary antibodies used for the detection of proteins are Anti-CRY1 (Bethyl) ...
-
bioRxiv - Immunology 2024Quote: ... the samples underwent sodium dodecyl sulfate-polyacrylamide gel electrophoresis for separation and were then transferred to a polyvinylidene fluoride membrane (Millipore). The membrane was blocked using the primary antibody-blocking solution and then incubated overnight at 4 °C with primary antibodies against P16 ...
-
bioRxiv - Genetics 2024Quote: ... Cells were plated at different dilutions onto solid SC-Arg medium with or without 250 μg/mL of canavanine sulfate (Sigma). Plates were grown for 4 days at 30°C and stored at 4°C for 1 day to allow colony color development ...
-
bioRxiv - Plant Biology 2024Quote: ... Total proteins were extracted using denaturing buffer (100 mM Tris-HCl pH 7.5, 4% SDS (sodium dodecyl sulfate, Sigma-Aldrich), 20% glycerol ...
-
bioRxiv - Cell Biology 2024Quote: ... were separated by 8 % sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS/PAGE) and then transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore) at 120 V for 2 hours using transfer buffer (25 mM Tris-base ...
-
bioRxiv - Developmental Biology 2024Quote: ... The protein lysates were electrophoretically separated on sodium dodecyl sulfate-polyacrylamide gels and electrically transferred to polyvinylidene fluoride membranes (IPVH00010, Millipore). The membranes were blocked in 5% skimmed milk for 1 hour and incubated with the primary antibodies (Table S6 ...
-
bioRxiv - Plant Biology 2019Quote: ... A ratio of 1:2 and 1:3 (v/v) polyvinylpolypyrrolidone (PVPP, ~110 µm particle size, Sigma-Aldrich, Saint Louis, USA) to ground tissue was used ...
-
bioRxiv - Cell Biology 2022Quote: ... To induce the auxin-degron system in DLD-1 cells, 500 µM indole-3-acetic (A10556, Fisher) and 500 µg ml−1 doxycycline (Sigma, D9891) were added to the media and cells incubated for 24 h.
-
bioRxiv - Developmental Biology 2019Quote: ... Western blots were incubated with the following primary antibodies for 1 hour at room temperature in 3% milk: 1:4000 M2 Flag (Sigma 3165),1:4000 H3 (Cell Signaling 4499) ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were incubated at 37 °C for 30 min to achieve maximum polymerization and then were mixed in a 1:1 volume ratio with pre-warmed PM buffer containing 3 mM MgCl2 and 2% Methylcellulose (MO512, Sigma-Aldrich). Final concentrations of protein ...
-
bioRxiv - Neuroscience 2021Quote: ... Brains were homogenized in 3:1 (v/w) of PBS containing 1% Triton X-100 supplemented with protease inhibitors (cOmplete™, Sigma) using the TissueRuptor (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... Pellets were resuspended in urea buffer (50mM Tris HCl pH 7.5, 5mM EDTA, 6M Urea, 1% SDS, 1mM PMSF, 1:100 Phosphatase Inhibitor Cocktail 3 [Sigma-Aldrich P0044]) and cells were lysed by bead beating ...
-
bioRxiv - Biochemistry 2022Quote: ... they were cultivated 72 hours in the presence of 2 μM DL-threo-1-phenyl-2-palmitoylamino-3-morpholino-1-propanol (PPMP) (Sigma-Aldrich) to inhibit the synthesis of glucosylceramide-based GSLs 75 and incubated with fluorescent SaroL-1 as previously described ...
-
bioRxiv - Neuroscience 2021Quote: ... plus 5% normal goat serum for 1 hr at RT before 3 d incubation in primary antibody diluted in block (1:1,000, chicken anti-GFP, Abcam, ab13970; 1:200 rabbit anti-cleaved caspase 3, EMD Millipore, AB3623). Sections were washed several times in TBS ...
-
bioRxiv - Neuroscience 2020Quote: ... Tissue samples from brain and peripheral organs were homogenized in 3:1 (v/w) of PBS containing 1% Triton X-100 supplemented with protease inhibitors (cOmplete™, Sigma) using the TissueRuptor (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... Cleaned tissue samples were incubated at 37 °C for 1 h in 10 mL DPBS with 1 mM DTT and 3 mM EDTA (Sigma-Aldrich). After incubation ...
-
bioRxiv - Systems Biology 2020Quote: ... 120μL of 1:1 DTNB:GR solution (DTNB: 2mg 5,5’-dithiobis(2-nitrobenzoic acid) (Sigma-Aldrich; Cat#D8130; CAS: 69-78-3) in 3mL KPE ...
-
bioRxiv - Cancer Biology 2020Quote: ... pelleted, and re-suspended in lysis buffer (1 mM CaCl2, 3 mM MgCl, 1mM EDTA, 1% Triton X-100 (Sigma-Aldrich), 10 mM TrisHCl ...
-
bioRxiv - Microbiology 2021Quote: ... Allicin was synthesized by oxidation of 3-[(Prop-2-en-1-yl)disulfanyl]prop-1-ene (diallyl disulfide, Sigma-Aldrich, Germany) with peracetic-acid (glacial acetic acid/H2O2 ...
-
bioRxiv - Bioengineering 2022Quote: ... A stock solution of 3 mg/mL rat tail collagen type I was neutralized with 1% 1 M NaOH (Sigma, S5761) and 10% 10x phosphate buffered saline ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with fresh protease inhibitors (3 µg/mL Leupeptin, 1 µg/mL macroglobulin, 1 µM benzamidine, 0.5 µM PMSF) and phosphatase Inhibitors (EMD Millipore, 524625). Cell lysates were incubated 10 minutes on ice and centrifuged at 13000 rpm for 10 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... supplemented with 10% (BC-1, BCBL-1) or 20% (BC-2, BC-3, BC-5, BJAB) Serum Plus-II (Sigma-Aldrich, catalog number 14009C ...
-
bioRxiv - Developmental Biology 2023Quote: ... 10 mM NaCl, 3 mM MgCl2, 0.1% Tween-20, 1% BSA, 1 mM DTT, 0.1 U/µl Sigma Protector RNase Inhibitor) was then added to the cell lysis and the nuclei were pelleted by centrifuging at 500xg for 5 minutes at 4°C ...
-
bioRxiv - Systems Biology 2023Quote: ... 6 M Urea and 1% Sodium Dodecyl Sulphate supplemented with 100mM phenylmethylsulfonyl fluoride and 1% phosphatase inhibitor cocktail 3 (Sigma-Aldrich)) ...
-
bioRxiv - Microbiology 2024Quote: ... parasite pellets were placed on ice for 5 min before addition of 50 μl chloroform followed by 200 μl methanol:ultrapure water (3:1, including scyllo inositol as an internal standard, 1 nmol, Sigma-Aldrich, I8132). Extraction was facilitated through vigorous vortexing ...
-
bioRxiv - Microbiology 2024Quote: For the leukopenic model mice were immunosuppressed with 150 mg/kg of cyclophosphamide (Baxter) on days −3 and −1 plus 1 subcutaneous injection of 250 mg/kg hydrocortisone 21-Acetate (Sigma-Aldrich) on day −1 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2020Quote: ... 14-3-3 antibody and active recombinant AMPK (α2β1γ1) were from Millipore. Precast Tris-Glycine polyacrylamide gels and 10X tris-glycine gel electrophoresis buffer were from BioRad ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...