Labshake search
Citations for Millipore Sigma :
151 - 200 of 10000+ citations for pLenti CMV TO Puro DEST 670 1 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... ythdc2 and piwil1 were subcloned into a pFLAG-CMV-5a expression vector (Sigma-Aldrich) by using EcoRI and SalI ...
-
bioRxiv - Biochemistry 2020Quote: ... The pCMV-FLAG-His6-NPC1L1-MLD was cloned in the pFLAG-CMV-3 plasmid (Sigma). This construct contains a pre-protrypsin signal sequence ...
-
bioRxiv - Immunology 2021Quote: ... Full-length RIAM cDNA was cloned into p3xFlag-CMV-7.1 (Sigma-Aldrich, St. Louis, MO). Constructs encoding EGFP-tagged full-length talin1 WT were previously described(Wegener et al. ...
-
bioRxiv - Genomics 2024Quote: Plasmid pLKO-puro shRNA clones (Mission shRNA) were purchased from Sigma (SHC016 (shCTRL); TRCN0000000993 (shMAP3K5) ...
-
bioRxiv - Neuroscience 2024Quote: ... Glia were transduced with ShRNA-Sema6a-puro-GFPtag lentivirus (Millipore Sigma Cat#: SHCLNV), ShRNA-GJA1-puro-GFPtag lentivirus (Millipore Sigma Cat# ...
-
bioRxiv - Molecular Biology 2020Quote: Lentiviral pLKO.1-puro empty vector control plasmid and human TENT4A shRNA pLKO.1-puro plasmid (clone TRCN0000053036, target sequence CCAACAATCAGACCAGGTTTA) were obtained from Sigma (Mission shRNA library). Lentiviruses were produced in 293FT cells ...
-
bioRxiv - Genomics 2022Quote: ... full length human LINC00881 was cloned into p3XFLAG-CMV-7 (Millipore Sigma, St. Louis, MO, USA) vector and amplified in DH5α strain of Escherichia coli (E coli ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibodies used in this paper are mouse anti-CMV IE1/2 monoclonal antibody (MAB8131, Millipore), mouse anti-CMV pp52 monoclonal antibody (CH16 ...
-
bioRxiv - Microbiology 2021Quote: ... and transfer vector (pLenti-EF1A-EGFP-Blast or pLenti-EF1A-hC1QBP[NM_001212.4]-Blast) using the X-tremeGENE 9 DNA transfection reagent (Sigma-Aldrich; # 6365787001) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Huh7 GADD34 Puro cells (13) were supplemented with 3 μg/ml puromycin (Sigma-Aldrich). Huh7.5 cells (71 ...
-
bioRxiv - Genomics 2022Quote: Non-targeting shRNA construct was obtained from Sigma (SHC202; pLKO.5-puro Control Plasmid). Zfp281 targeting shRNA gene was obtained from Sigma (Clone ID ...
-
bioRxiv - Genomics 2022Quote: ... Zfp281 targeting shRNA gene was obtained from Sigma (Clone ID: TRCN0000255746) and cloned into the pLKO.5-puro lentiviral construct (Sigma SHC201). For over-expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... and non-targeting control shRNA (pLKO.1-puro non-Target shRNA Control; referred to as shCtrl) were obtained from Sigma (MISSION® shRNA Library), amplified ...
-
bioRxiv - Cell Biology 2021Quote: ... Full-length α-taxilin and γ-taxilin were also cloned into p3×FLAG-CMV-14 (Sigma-Aldrich). Ninein-GFP ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNA fragment encoding Cyp7b1 (NM_007825) was amplified and cloned into p3×FLAG-CMV-10 vector (Sigma) using EcoRI/KpnI restriction enzyme sites to construct pCMV10-3×FLAG-mCyp7b1.
-
bioRxiv - Cancer Biology 2023Quote: ... Full-length cDNA was cloned in p3XFLAG-CMV™-10 vector (Sigma-Aldrich, St Louis, MO, USA) such that the 3X-FLAG tag at its 5’end was in the same reading frame as DDX3X ...
-
bioRxiv - Microbiology 2024Quote: ... and 1000 ng/well pTRIP-CMV-Effector-IVSb-IRES-TagRFP using X-tremeGENE 9 (Sigma XTG9-RO) and OptiMEM (Thermo 31985062) ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 5 uL CMV-GFP-T2A-Luciferase lentivirus (Systems Biosciences) and 8 ug/mL polybrene (Milipore Sigma). Medium was changed after 3 days to allow cells to recover ...
-
bioRxiv - Plant Biology 2022Quote: ... and puro-polypeptides were detected by western blotting with an anti-puromycin antibody (Millipore, MABE343) at a dilution of 1:10,000 ...
-
bioRxiv - Biophysics 2022Quote: ... the old medium was replaced by fresh DMEM-Puro+ medium ( 1.5 μg/mL puromycin, Sigma) for 3-day culturing ...
-
bioRxiv - Cancer Biology 2021Quote: ... ERK5 was silenced with human or mouse shRNAs purchased as pre-cloned in the pLKO.1-puro plasmid (MISSION® shRNA, Sigma-Aldrich, St Louis, MO, USA). Control shRNAs in the same plasmid were also purchased (Sigma) ...
-
bioRxiv - Neuroscience 2024Quote: ... received a non-target shRNA viral injection (NT-shRNA; SHC016: MISSION® pLKO.1-puro non-Target shRNA Control Plasmid DNA; Sigma Aldrich, St. Louis, MA, USA) to determine any effects of surgery and viral constructs on respiratory behaviour ...
-
bioRxiv - Immunology 2021Quote: ... Coding sequences of β- and α- PTSN were cloned into pEGFP-C1 and p3xFlag-CMV-7.1 (Sigma-Aldrich). β- PTSN 4A mutation (residues K539 ...
-
bioRxiv - Cancer Biology 2021Quote: CDC20 cDNA was cloned into the multiple cloning site of the expression vector p3XFLAG-myc-CMV-26 (Sigma). Site-directed mutagenesis was used to generate the CDC20 mutants of interest ...
-
bioRxiv - Bioengineering 2020Quote: ... Transduction was carried out using CMV-GFP lentiviruses in growth media with 8 μg/ml polybrene (Sigma-Aldrich) for 3-4 hours.
-
bioRxiv - Genomics 2021Quote: ... The guide RNA and Cas9 were cloned into the vector U6-gRNA/CMV-Cas9-GFP (Millipore Sigma, USA) and each pair of guides were transfected at 10μg into 72 wells of low-density (∼10,000 cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mammalian expression construct for FLAG-VCF1 was generated by inserting VCF1 cDNA into p-FLAG-CMV-2 (Sigma). Point mutations were introduced using the Q5 Site-Directed Mutagenesis kit (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2022Quote: ... or negative control shRNA (TRC2 pLKO.5-puro Non-Target shRNA Control Plasmid DNA, SHC216, Sigma) were transfected to 60-70% confluent 293T cells grown on 6-well plates (1156D98 ...
-
bioRxiv - Cell Biology 2022Quote: Huh7 cells or Huh7 GADD34 Puro cells were incubated with 100 μg/ml cycloheximide (Sigma-Aldrich) and harvested at different times after treatment ...
-
bioRxiv - Cell Biology 2022Quote: ... WT HeLa cells and TEX264-KO HeLa cells stably expressing the ER-phagy reporter pCW57.1-CMV-ssRFPGFP-KDEL (Chino et al., 2019) were cultured with 0.5 μg/mL doxycycline (D3447; Sigma-Aldrich) for 24 h ...
-
bioRxiv - Immunology 2020Quote: ... Cells were stained with 0.25 μg/well of an AlexaFluor 488-conjugated anti-CMV-immediate-early antibody (clone 8B1.2; Sigma-Aldrich), and samples were used only if >75% infected and if the variance between samples was <15%.
-
bioRxiv - Cell Biology 2020Quote: ... A CDS of RPL11 was amplified from an HT1080 cDNA pool and inserted into the EcoRI/BglII-digested p3xFLAG-CMV-7.1 (Sigma) to attach the 3xFLAG tag at its N-terminus ...
-
bioRxiv - Immunology 2024Quote: ... PCR was performed to add the 3XFlag tag to the N terminus of ZBP1 cDNA at the 5’ Not1 site and 3’ Sal1 site to facilitate cloning into expressing vector p3XFlag-CMV-7.1 (Sigma). The resulting plasmid containing the 3XFlag-ZBP1 was further subcloned in the Bst1 and BamHI sites of the vector pLVX-EF1α-AcGFP1-C1 (Takara ...
-
bioRxiv - Cell Biology 2024Quote: ... 1.5 µg of CMV-VSV.G (NIAID) and 12 µL of linear polyethyleneimine MW-25,000 (final concentration of 5 µg/µL)(Sigma-Aldrich)) and incubated overnight for 8 hours ...
-
bioRxiv - Genomics 2022Quote: ... using as lentivirus backbone the LV01 U6-gRNA:ef1a-puro-2A-Cas9-2A-tGFP targeting USP47 (Sigma Aldrich). The target sequence (5’-3’ ...
-
bioRxiv - Molecular Biology 2024Quote: ... RPE1-iCas9 cells were transfected with pU6-gRNA:PGK-puro-2A-tagBFP (Sigma–Aldrich library from the LUMC) containing 2 gRNAs against XPC ...
-
bioRxiv - Genetics 2020Quote: ... wild-type and mutant LIR-2s were N-terminally FLAG-tagged using the p3xFLAG-CMV-10 expression vector (SIGMA-Aldrich). For co-immunoprecipitation ...
-
bioRxiv - Neuroscience 2022Quote: ... p.G102A (Caballero Oteyza et al. 2014) KIF1C open reading frame in a pSF-CMV-UB-NEO/G418 ASCI (Sigma-Aldrich) backbone and cultured cells under neomycin selection conditions ...
-
bioRxiv - Microbiology 2024Quote: ... and 600 ng of a wt ORF57 (pVM7) expression vector or an empty FLAG control vector (pFLAG-CMV-5.1, Millipore Sigma). After 24 h of transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... HeLa cells were transfected with U6-gDNA (5’-AAAGACGTCCCTAACAAGT-3’; clone ID es: HSPD0000063884): CMV-eCas9-2a-tGFP (Sigma-Aldrich). 48h after transfection ...
-
bioRxiv - Cell Biology 2023Quote: The C19orf43.WT plasmid is comprised of an N-terminal 3x Flag tag followed by human full length C19orf43 cloned into the p3XFlag-CMV-10 vector (Sigma). C19orf43.R7G was obtained by mutating the arginine at position 7 to glycine and C19orf43.R106G was obtained by mutating the arginine at position 106 to glycine ...
-
bioRxiv - Cell Biology 2023Quote: ... Inserted products were excised using the Hind III restriction site and ligated into pre-digested p3xFLAG-CMV-14 (Sigma Aldrich) cut with the same enzyme.
-
bioRxiv - Biophysics 2024Quote: NIH-3T3 nesprin-3 knockout cells were generated by using CRISPR/Cas9 by transfecting cells with an All-in-One U6-gRNA/CMV-Cas9-tGFP Vector (Sigma) using gRNA sequence ...
-
bioRxiv - Cell Biology 2022Quote: ... rtTA-Puro and TetO-Carm1-IRES-TdTomato were induced with 1µg/ml of doxycycline (Sigma-Aldrich, Cat#D9891). GFP+ and TdTomato+ cells were single cell-sorted using either FACS Aria or Influx cell sorters.
-
bioRxiv - Cancer Biology 2024Quote: ... TC32EF;SMASh cells were transduced with pLVX-EWSR1-FLI1-IRES-Puro lentivirus and selected with puromycin (Sigma P8833).
-
bioRxiv - Cell Biology 2021Quote: ... The cyclin D1-Flag plasmid was generated by PCR insertion of cyclinD1 into the p3XFLAG-CMV™-14 expression vector (Sigma). The XPack-GFP plasmid was generated by inserting GFP from pEGFP-N1 (BD Biosciences Clontech ...
-
bioRxiv - Cell Biology 2022Quote: ... pLKO.1-puro-CMV-tGFP plasmids targeting SNX5 (5’-ACTATTACAATAGGATCAAAG-3’, 5’-CTGAGTATCTCGCTGTGTTTA-3’) and SNX6 (5’-AGTAAAGGATGTAGATGATTT-3’, 5’-GCCGAAACTTCCCAACAATTA-3’) (Sigma-Aldrich) were lentivirally transduced ...
-
bioRxiv - Cell Biology 2022Quote: ... 3xFLAG-Lc3b was made by cloning the Lc3b sequence into the HindIII and KpnI sites of the vector p3xFLAG-CMV-10 (Sigma Aldrich). mCherry-Lc3b and GFP-Lc3b were made by cloning Lc3b into the EcoRI and BamHI sites of pEGFP-C1 (Clontech Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... Human full length SPAG5 ORF (ATG1-SPAG5) or excluding the first 453 nucleotides (Δ151-SPAG5) were cloned into p3xFLAG-CMV-14 (Sigma-Aldrich) using NotI or NotI/ClaI restriction sites ...
-
bioRxiv - Cancer Biology 2020Quote: ... PRL-3 over expressing construct was made by cloning full length PRL-3 cDNA into p3XFLAG-CMV-14 expression vector (Sigma, E7908)