Labshake search
Citations for Millipore Sigma :
101 - 150 of 10000+ citations for pLenti CMV TO Puro DEST 670 1 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... The shRNAs in pLKO.1-puro (MET MISSION Lentiviral Transduction shRNA particle) were commercially purchased from Sigma (Cat ...
-
bioRxiv - Cancer Biology 2022Quote: MISSION® pLKO.1-puro Non-Mammalian shRNA (SHC002) and WDR5 knockdown plasmids were purchased from Sigma. Several clones were tested ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lentiviral shRNA constructs in the pLKO.1-puro vector were purchased as glycerol stocks from Millipore Sigma. For shADAR1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and shCtrl-2 (MISSION® pLKO.1-puro non-mammalian shRNA Control Plasmid DNA, SHC002, Sigma-Aldrich).
-
bioRxiv - Developmental Biology 2022Quote: 300k SV-HUC-1 cells were seeded and transfected with 3µg MISSON pLKO.1-puro non-mammalian targeting control shRNA (Sigma, Cat# SHC002) or shExoc5 (Sigma ...
-
bioRxiv - Plant Biology 2020Quote: ... The PCR conditions were set up to amplify only the short 670 bp product using REDExtract-N-Amp PCR ReadyMix (Sigma). PCR conditions ...
-
bioRxiv - Cancer Biology 2022Quote: ... the MISSION TRC2 pLKO.5-puro plasmid (Sigma-Aldrich) was modified to replace the puromycin-resistance gene with the enhanced green fluorescent protein (EGFP ...
-
bioRxiv - Neuroscience 2024Quote: ... ShRNA-GJA1-puro-GFPtag lentivirus (Millipore Sigma Cat#: SHCLNV), or ShRNA-GFP-puro control lentivirus (Millipore Sigma cat# ...
-
bioRxiv - Biochemistry 2021Quote: ... The resulting fragments were subsequently cloned into p3xFLAG-CMV-14 (Sigma) or pGEX-6P-1 (GE Healthcare ...
-
bioRxiv - Cancer Biology 2020Quote: ... TRCN0000028509 (sh-AC2) and the scramble control pLKO.1-Puro plasmid (sh-scr) were obtained from Sigma-Aldrich. The sequence of shRNAs are:
-
bioRxiv - Cancer Biology 2023Quote: Four Lenti-pLKO.1-puro shRNA vectors that specifically targeted COL7A1 mRNA sequences were chemically synthesized (Sigma Aldrich) and included in viral particles:
-
bioRxiv - Cell Biology 2023Quote: ... we used the MISSION shRNA lentiviral plasmids pLKO.1-puro with shRNA target sequence CCAGATGACTTGATCGGATAT (TRCN0000190340, Millipore Sigma) and pLKO.005-puro with shRNA target sequence GTTGGCCTGAACCTGCTTTAT (TRCN0000382281 ...
-
bioRxiv - Genomics 2023Quote: ... The MEF2B shRNA sequences inserted in a pLKO-1 puro plasmid are listed in Table S4 (Sigma, #SHCLNG).
-
bioRxiv - Bioengineering 2021Quote: ... we labeled a single lysine group on a portion of our ELPs with a cyanine-5 (Cy5) NHS molecule (excitation: 651, emission: 670; Sigma 679011) via standard NHS-ester chemistry ...
-
bioRxiv - Cell Biology 2022Quote: ... equal number of DB-VOs and control ND-VOs were labelled by LuminiCell Tracker 670-Cell Labeling Kit (SCT011, Sigma-Aldrich), 0.8nm for 12 hours in Stempro34 complete medium ...
-
bioRxiv - Microbiology 2022Quote: ... shRNA is in TRC2-pLKO-puro vector (SHC201 Sigma-Aldrich) background with puromycin as a mammalian selection marker ...
-
bioRxiv - Neuroscience 2024Quote: ... or ShRNA-GFP-puro control lentivirus (Millipore Sigma cat#: SHC005V) in Glia Media for 24 hrs ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR products were inserted into p3×FLAG-CMV-10 vector (Sigma-Aldrich) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Biochemistry 2024Quote: ... human full length NHE1 was cloned into p3xFLAG-CMV-14 (Sigma-Aldrich) containing a C-terminal 3xFLAG tag ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells transfected with the pSpCas9(BB)-2A-Puro plasmid (sgRNAs 1) were treated with 1 μg/mL puromycin (Sigma-Aldrich, 58-58-2) 24 hours after transfection and were selected for 96 hours ...
-
bioRxiv - Cancer Biology 2020Quote: ... two short hairpin RNAs (shRNA) targeting SLX4IP in the pLKO.1-puro lentiviral expression plasmid were purchased from Sigma (Clone ID NM_001009608.1-426s1c1 and NM_001009608.1-247s1c1) ...
-
bioRxiv - Biochemistry 2021Quote: ... HeLa S3 and HCT116 pLVX-TetOne-Puro cell lines were grown under Puromycin selection (1 μg/ml, P8833, Sigma). In Hela S3 and HCT116 pLVX-TetOne-Puro ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1-puro shRNA plasmid DNA was isolated from bacteria glycerol stocks (IFNAR1: TRCN0000301483, PD-L1: TRCN0000068001; Sigma Aldrich) using E.Z.N.A.® Plasmid Mini Kit I (Omega Bio-tek ...
-
bioRxiv - Molecular Biology 2023Quote: ... For shRNA knockdown with lentiviral infection, Mission shRNAPP4C (pLKO.1-puro, Clon ID #TRCN0000080835) were obtained from Sigma-Aldrich, Inc ...
-
bioRxiv - Cancer Biology 2023Quote: ... Trono (Ecole Polytechnique Federale de Lausanne, Lausanne, Swisse)] and MISSION pLKO.1-puro-based vectors (Sigma-Aldrich, Madrid, Spain,) encoding either a non-targeting shRNA (SHC002 ...
-
bioRxiv - Microbiology 2021Quote: ... Flag- and HA-tagged wide-type and truncates of DDX21 (1-125, 127-784, Δ1-216, Δ574-784) were constructed by inserting indicated sequences into p3XFLAG-CMV-14 (Sigma-Aldrich) and pCMV-HA (Promega) ...
-
bioRxiv - Cancer Biology 2021Quote: ... To deplete mouse STK3 expression in HMVP2 cells TRC2 MISSION shRNAs in pLKO.1-puro vector backbone were used (Millipore-Sigma). Lentivirus was generated with psPAX2 and pMD2.G packaging plasmids using with the Polyplus jetPRIME transfection kit in 293T cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lenti293 packing cells were plated at 6 × 105 cells/well in six-well tissue culture plates and transfected with pLKO.1-puro lentiviral empty vector or shCCM1 vector (Sigma) using X-treme GENE HP DNA transfection Reagent (Roche) ...
-
bioRxiv - Cancer Biology 2020Quote: ... were infected with lentiviral pLKO.1-puro vectors expressing specific shRNA sequences for 24 h in the presence of polybrene (8μg/ml; Sigma-Aldrich). After further 24 hrs ...
-
bioRxiv - Genetics 2020Quote: Previously validated shRNA-encoding oligos targeting murine Ubr5 and or a scrambled sequence were cloned into pLKO.1-puro (Sigma). shUBR5 and shScrambled-pLKO.1-puro were co-transfected with pCMV-VSV-G and pCMV-dR8.2 dvpr plasmids into HEK 293T cells using TransIT293 reagent (Mirus Bio LLC ...
-
bioRxiv - Cancer Biology 2021Quote: ... were subjected to lentiviral transduction with either the Tg2-targeting MISSION shRNA plasmid (SHCLND-NM_004613: TRCN0000272816) (MDA- (scr)) or the MISSION scr.1-puro scrambled control plasmid DNA (SHC001; Millipore Sigma) (MDA- (shTg2)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... As a negative control a plasmid expressing the scramble sequence (MISSION pLKO.1-puro shRNA Control Plasmid DNA) was purchased from Sigma- Aldrich.
-
bioRxiv - Cancer Biology 2023Quote: ... MDA-MB-231 and MDA-MB-453 cells were transduced with pSIEW-GFP/Puro vector at MOI<1 by 30 min spinoculation at 1000xg in the presence of 8µg/ml Polybrene (Sigma-Aldrich) to produce MDA-MB-231 GFP and MDA-MB-453 GFP ...
-
bioRxiv - Neuroscience 2024Quote: ... the ccnd1 MISSION shRNA TRCN0000026883 and the control SHC002 cloned in a pLKO.1-puro were obtained from Sigma-Aldrich. MEFs were infected and selected with Puromycin.
-
bioRxiv - Biochemistry 2022Quote: ... or −3 human cDNA into a p3XFLAG-CMV-14 expression vector (Sigma, E7908). Then 3XFLAG-PRLs were cloned into pLenti-CMV-puro (Addgene 17452 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and CRISPR-Cas9 with a GFP reporter (Sigma Cat# CMV-CAS9-2A-GFP), and flow sorted based on expression of GFP and BFP reporters and absence of CD81/Cd81 ...
-
bioRxiv - Molecular Biology 2020Quote: ... H1299 cells were transfected with the p3×FLAG-CMV 10 vector (Sigma-Aldrich) containing human full-length NRF3 or GFP ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were kindly gifted by Dr Simon Langdon (University of Edinburgh, Edinburgh, UK) and labelled with GFP (pLKO.1-Neo-CMV-tGFP vector from Sigma-Aldrich, USA) to enable their identification within the 3D organotypic model ...
-
bioRxiv - Cancer Biology 2021Quote: ... To deplete mouse STK3 expression in HMVP2 cells TRC2 MISSION shRNAs in pLKO.1-puro vector backbone were used (Millipore-Sigma). Lentivirus was generated with psPAX2 and pMD2.G packaging plasmids using with the Polyplus jetPRIME transfection kit in 293T cells ...
-
bioRxiv - Cell Biology 2021Quote: ... GBM#U3013 cells were infected with lentiviral particles generated by transfecting HEK293 cells with pLKO.1-puro plasmids from the Mission shRNA library (Sigma-Aldrich). Briefly ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stable KD of EIF4G2 was generated by infecting HEC-1A or RL95-2 cells with lentiviruses harboring pLKO.1-puro plasmid expressing shRNA targeting GFP (Control) or shRNA targeting EIF4G2 (Sigma TRCN0000147914), followed by selection using puromycin ...
-
bioRxiv - Microbiology 2024Quote: ... HEK 293FT cells were transfected with 1μg of TRC-pLKO.1-Puro plasmid containing either non-targeting shRNA (5’-CAACAAGATGAAGAGCACCAA-3’) or ATF4-targeted shRNA (5’-GCCTAGGTCTCTTAGATGATT-3’) (Sigma-Aldrich), together with 1 μg mixture of packaging plasmids (pMD2.G and psPAX2 ...
-
bioRxiv - Cell Biology 2024Quote: ... The lentiviral shRNA hairpin expression plasmids for BCAT2 and KLF15 were constructed by cloning the synthetic oligonucleotides into the pLKO.1 puro plasmid (Sigma-Aldrich). The shRNA target sequences were as follows.
-
bioRxiv - Cancer Biology 2020Quote: ... pLKO-puro-shOSMR lentiviral vectors were purchased from Sigma-Aldrich (NM_003999.1-1342S21C1). Lentiviral infections were performed as previously described42.
-
bioRxiv - Immunology 2020Quote: Plasmid included Mission® pLKO-puro Non-Target shRNA (Sigma-Aldrich, #SHC016V), pLKO shRNA targeting BBS1 (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... and pLKO.005-puro with shRNA target sequence GTTGGCCTGAACCTGCTTTAT (TRCN0000382281, Millipore Sigma), as clones 1 and 2 ...
-
bioRxiv - Microbiology 2020Quote: ... These S-o and S-n were cloned in to p3xFLAG-CMV-9 (Sigma) and pCMV3-SP-N-MYC (Sino Biological ...
-
bioRxiv - Microbiology 2022Quote: ... Plates with Towne virus were stained with mouse anti-human CMV IE1 (MAB810, Millipore) then goat anti-mouse IgG-AF488 (Millipore) ...
-
bioRxiv - Genomics 2021Quote: ... the blasticidin resistance gene was amplified from PSF-CMV-BLAST (Sigma-Aldrich, OGS588-5UG). Amplifications were performed with the Q5 High-Fidelity DNA Polymerase (NEB ...
-
bioRxiv - Cell Biology 2024Quote: cDNA for CENP-T full-length sequence was cloned into p3xFLAG-CMV-10 (SIGMA). Several CENP-T mutants (CENP-TΔ161–216 ...