Labshake search
Citations for Millipore Sigma :
151 - 200 of 10000+ citations for Recombinant Human CD28 protein Biotin labelled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: Human recombinant SRPK2 (0.4 ug/reaction; EMD Millipore 14-666; Glu46-end) and SRSF2 (0.8 ug/reaction ...
-
bioRxiv - Immunology 2021Quote: ... were coated with 100 ng/well recombinant human ACE2 (hACE2) (Sigma-Aldrich) in PBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were treated with 400ng/mL of human recombinant leptin (Sigma #L4146). In leptin neutralization studies ...
-
bioRxiv - Microbiology 2021Quote: ... and 40 ng/mL bFGF (basic recombinant human fibroblast growth factor; Sigma) in flasks coated first with 50 µg/mL poly-L-ornithine (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... 40 ng/ml recombinant human long-range IGF-1 (Sigma-Aldrich, USA), 5 ng/ml recombinant IL-6/soluble IL-6R fusion protein ((Fischer et al. ...
-
bioRxiv - Biochemistry 2021Quote: Limited proteolysis experiments were conducted with recombinant human cathepsin S (Milipore-Sigma) diluted in phosphate-citrate buffer at pH 5.6 and 37 °C(21) ...
-
bioRxiv - Cell Biology 2019Quote: Recombinant human holo-lactoferrin (iron-saturated) (L1294) was purchased from Sigma-Aldrich. Aliquots were prepared by resuspending in PBS at a concentration of 1 mg/ml and were stored at −20 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... PANC0813 medium was supplemented with 10units/mL human recombinant insulin (Sigma-Aldrich), and MHHNB11 medium was supplemented with MEM Non-Essential Amino Acids (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2023Quote: ... PANC0813 medium was supplemented with 10units/mL human recombinant insulin (Sigma-Aldrich), and MHHNB11 medium was supplemented with MEM Non-Essential Amino Acids (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... Cells that received Interferon-β pre-treatment were stimulated for 18 hours with 100 units of recombinant human Interferon-β protein (Millipore, IF014) prior to infection.
-
bioRxiv - Cell Biology 2019Quote: Purified proteins in indicated concentrations were incubated with fluorescently labelled ssODN (Sigma) (0.25μM-6-FAM-39mer-5’GCGCGCCCATTGATACTAAATTCAAGGATGACTTATTTC3’ ...
-
A sound strategy for homology modeling-based affinity maturation of a HIF-1α single-domain intrabodybioRxiv - Biochemistry 2020Quote: ... The recombinant protein was produced in Rosetta (DE3) cells (Novagen) and purified by affinity chromatography using a GSTrapFF column ...
-
bioRxiv - Microbiology 2021Quote: Recombinant proteins were created using the pET expression system (Novagen). The codon-optimized typical faeG gene of the original K88 (K88ac variant ...
-
bioRxiv - Cell Biology 2021Quote: ... recombinant protein was induced with 1 mM IPTG (Sigma – Aldrich) and the culture was transferred to 25°C and 250 rpm for 5 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... active recombinant proteins were purchased from Sigma (SRP0364, P0066, respectively). Recombinant purified human MASTL protein was used as a substrate and was from Abnova (H00084930) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant proteins were expressed in either BL21 or Rosetta (Novagen) cells ...
-
bioRxiv - Molecular Biology 2021Quote: Recombinant proteins were expressed in Escherichia coli RosettaTM (DE3) (Millipore) by induction overnight with 0.5 mM isopropyl β-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 103 units/mL ESGRO Recombinant Mouse LIF Protein (Millipore #ESG1107), 3.0 µM CHIR99021 (GSK-3 inhibitor ...
-
bioRxiv - Molecular Biology 2023Quote: ... LPA and recombinant Src protein were purchased from Sigma-Aldrich, while recombinant human IDO1 protein was obtained by Giotto Biotech ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1000 U/ml ESGRO recombinant mouse LIF protein (Sigma ESG1106), 2 μM PD0325901 (Selleckchem S1036 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and oligonucleotides recognizing both lacO (5′-CATGTGGAATTGTGAGCGGATAACAATTTGTGG-3′) and Gal4 (5′-TCGACGGAGGACAGTCCTCCG-3′) sequences labelled with Biotin were purchased (Sigma). Oligonucleotides were mixed at 100 ng/μL and resuspended in hybridization buffer (50% formamide ...
-
bioRxiv - Microbiology 2023Quote: ... Cyst walls were stained with a 1/300 dilution of a biotin-labelled Dolichos biflorus lectin (L-6533, Sigma-Aldrich) for 1h and revealed using a 1/300 dilution of FITC-conjugated streptavidin (SNN1008 ...
-
bioRxiv - Immunology 2022Quote: ... human RBCs were biotinylated with controled concentration of biotin-X-NHS linker (Millipore/Sigma). The biotinylated RBCs were sequentially incubated with saturating amount of streptavidin (ThermoFisher ...
-
bioRxiv - Immunology 2022Quote: ... human RBCs were biotinylated with controled concentration of biotin-X-NHS linker (Millipore/Sigma). The biotinylated RBCs were sequentially incubated with saturating amount of streptavidin (ThermoFisher ...
-
bioRxiv - Genetics 2023Quote: ... Protein expression was verified and quantified by Western blot using recombinant GST protein (Sigma, G5663) as expression standards ...
-
bioRxiv - Bioengineering 2022Quote: Biotinylated proteins were obtained using Biotin N-hydroxysuccinimide ester reagent (Sigma Aldrich) according to the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant proteases were obtained from the following vendors: human cathepsin L (Millipore Sigma, Athens Research and Technology ...
-
bioRxiv - Biophysics 2020Quote: The recombinant human Mdm2 (1-125 aa) were cloned into pET11a vector (Novagen) and expressed in E ...
-
bioRxiv - Cell Biology 2020Quote: ... 100 ng/ml cholera toxin and 10 μg/ml recombinant human insulin (Sigma). MCF10A I-PpoI cells and MCF10A AsiSI cells were previously described (Harding et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... JSH23 (Cat# 481408) and Recombinant human IGF-1 (Cat# GF138) purchased from Millipore; JQ1 (Cat# M2167 ...
-
bioRxiv - Genomics 2022Quote: ... supplemented with 0.5 mg/mL recombinant human albumin (Sigma-Aldrich, St. Louis, MO), 213 μg/mL L-ascorbic acid 2-phosphate (Sigma-Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 10 ng/ml of human rIGF1 (recombinant Insulin growth factor-1) (Sigma, USA), 10 ng/ml amphotericin B ...
-
bioRxiv - Cell Biology 2020Quote: ... 200 ng/mL recombinant human IGF-1 (LONG R3-IGF-1; Sigma-Aldrich), and 20 ng/mL human bFGF (Life Technologies)] for 14 to 35 days ...
-
bioRxiv - Microbiology 2022Quote: ... and 200 nM of recombinant human purified E-cadherin (5085, Sigma-Aldrich, USA) for 1 h at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... After 16 h 50 ng/ml of recombinant human (rh)TGFA (Sigma-Aldrich) and/or Afatinib (5 µM ...
-
bioRxiv - Neuroscience 2023Quote: ... and human recombinant FGF-2 (10 ng/ml; Merck Millipore, Burlington, MA, USA) as mitogens ...
-
bioRxiv - Developmental Biology 2022Quote: ... 50 μL of sample or standard (Recombinant human IFN-α, IFNA: Millipore, IF007) were added ...
-
bioRxiv - Bioengineering 2023Quote: Insulin-azide and insulin-alkyne were prepared from recombinant human insulin (EMD Millipore) by selective acylation of the B29Lys residue as previously reported.33 ...
-
bioRxiv - Immunology 2022Quote: ... were coated with 100 ng per well recombinant human ACE2 (hACE2) (Sigma-Aldrich) in PBS ...
-
bioRxiv - Genetics 2022Quote: ... the beads were incubated in 10 μg/ml recombinant E-cadherin (human, Sigma) solution overnight at 4 °C with agitation ...
-
bioRxiv - Cell Biology 2023Quote: ... 200 ng/mL recombinant human IGF-1 (LONG R3-IGF-1; Sigma-Aldrich), and 20 ng/mL human bFGF (Life Technologies)] for 14 to 35 days.
-
bioRxiv - Biophysics 2023Quote: BCL-2 active humans (recombinant, expressed in E. coli) were purchased from Sigma. Navitoclax ...
-
bioRxiv - Neuroscience 2021Quote: ... Free-floating tissue sections were incubated overnight at room temperature for 22 hours using a 1:500 dilution of biotin-labelled Wisteria floribunda agglutinin (WFA) (L1516, Sigma-Aldrich) in PBS + 0.25% Triton X-100 ...
-
bioRxiv - Biophysics 2020Quote: ... Purified labelled protein was concentrated using a 50kDa MWCO centrifugal filter (EMD Millipore) and stored at −80°C in buffer containing 10mM Tris-HCl ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant proteins were induced in Rosetta™ (DE3) Competent Cells (Novagen) with 0.02% (w/v ...
-
bioRxiv - Biophysics 2021Quote: ... The recombinant proteins were first purified by Ni2+-affinity column (Novagen) under native conditions and subsequently in-gel cleavage by TEV protease was conducted ...
-
bioRxiv - Plant Biology 2022Quote: PIF3 recombinant proteins were prepared using PIF3-his DNA (pET28C, Novagen) provided by Ferenc Nagy and induced and purified using commercial kit (Amersham) ...
-
bioRxiv - Cell Biology 2020Quote: ... To induce recombinant proteins isopropyl-β-D-thiogalactoside (IPTG, Sigma-Aldrich) was added (0.1 mM ...
-
bioRxiv - Plant Biology 2019Quote: ... His-tagged recombinant protein was eluded with 250 mM imidazole (Sigma).
-
bioRxiv - Cell Biology 2021Quote: Recombinant protein expression vectors were constructed from the pET28a series (Novagen) encoding an N-terminal hexa-histidine tag and thrombin cleavage site.