Labshake search
Citations for Millipore Sigma :
1901 - 1950 of 2589 citations for Rat FAM24A shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... plasmids for different Cas9 proteins were expressed in Escherichia coli Rosetta2 (DE3) (Novagen). The protein expressing Rosetta2 (DE3 ...
-
bioRxiv - Cell Biology 2020Quote: The 6His-tagged-She1Cter expression plasmid for was constructed in pet28 vector (Novagen). The She1 C-terminal part coding for amino-acid 194 to 338 was cloned between the NdeI and XhoI site of the vector downstream of 6His and thrombin site.
-
bioRxiv - Biophysics 2020Quote: ... we transform the resulting plasmids verified by sequencing into BL21(DE3) cells (Novagen) for protein expression ...
-
bioRxiv - Molecular Biology 2021Quote: ... bL33 were PCR-amplified and cloned individually into the pET24(a) plasmid (Novagen). Similarly ...
-
bioRxiv - Developmental Biology 2020Quote: ... The completed plasmid was transformed into Rosetta BL21 cells (Millipore Sigma, 70954-3). A starter culture of 5 ml of Rosetta BL21 cells containing the completed plasmid were grown overnight at 37°C in LB with Kanamycin ...
-
bioRxiv - Molecular Biology 2020Quote: ... HEK 293T cells were transfected with Cdt1 expression plasmids using PEI Max (Sigma) and cultured for 16 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... pLKO.1-shDOT1L and pLKO.1-shSTING plasmids were obtained from Sigma-Aldrich with the following TRCN numbers ...
-
bioRxiv - Cancer Biology 2020Quote: ... CRISPR-Cas constructs U6-gRNA:CMV-eCas9-2a-tRFP (p05 transfection plasmid, Sigma-Aldrich) targeting human SLUG exon2 (target sequence ...
-
bioRxiv - Cell Biology 2022Quote: ... amplified from HUVEC cDNA and cloned in the pcDNA3.1 plasmid (Sigma-Aldrich, #E0648). All constructs were checked by full-length sequencing (Microsynth AG ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Both plasmids carry a gene for antibiotic resistance (Gentamicin 418, Sigma-Aldrich: G418). Vegetative growth was started from frozen aliquots thawed every week to prevent the accumulation of undesired mutations due to prolonged culturing ...
-
bioRxiv - Molecular Biology 2022Quote: ... calcium-phosphate and GenElute HP Plasmid Miniprep kit were acquired from Sigma-Aldrich. ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Neuroscience 2023Quote: ... The plasmid backbone was additionally treated with FastAP Thermosensitive Alkaline Phosphatase (Sigma Aldrich) after digestion to avoid re-ligation.
-
bioRxiv - Molecular Biology 2022Quote: ... Exonuclease plasmids were transformed into BL21 Rosetta 2(DE3) pLysS E.coli cells (Novagen) for expression ...
-
bioRxiv - Molecular Biology 2024Quote: ... The nucleotide sequence was synthesized by Genscript and cloned into the in vitro transcription/translation plasmid vector pCITE-4a(+) (Novagen), using the NcoI and BamHI sites which adds an S·tag to the amino-terminus and includes a stop codon at the carboxy terminus ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant plasmids were transformed into BL21 (DE3) or BL21 (DE3) Tuner cells (Novagen) and were incubated in 1L LB in 2L conical flasks at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plasmids were then transformed into Rosetta™ 2(DE3)pLysS Competent Cells (Novagen). Single colonies were used to inoculate a 40mL LB overnight starter culture ...
-
bioRxiv - Immunology 2024Quote: ... The pGEX-6-P1-PARP14291–358 plasmid was transformed into BL21(DE3) (Novagen) and selected overnight at 37°C on Luria-Bertani (LB ...
-
bioRxiv - Microbiology 2022Quote: ... and expression reporter plasmids were cloned using KOD Hot Start DNA Polymerase (Novagen). PCR and digestion products were purified using QIAquick PCR & Gel Cleanup kits (Qiagen) ...
-
bioRxiv - Genetics 2023Quote: ... TRC2-pLKO.5-puro-CMV-TurboGFP plasmid was used (SHC 203; Sigma-Aldrich). HEK293T cells were plated at 1 x105 cells per well of a 6 well plate and transfected with 1 µg of TRC2-pLK0.1 plasmid ...
-
bioRxiv - Biochemistry 2023Quote: ... The PCR product was subcloned and inserted into a pET-24b (+) plasmid (Novagen) digested with NheI/XhoI placing the gene upstream of a sequence encoding six histidine residues ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids containing various Shedu constructs were transformed into Novablue cells (EMD Millipore Sigma) and grown overnight on an LB plate supplemented with 50 µg/ml carbenicillin ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was obtained from Thermofisher Scientific (Waltham, Massachusetts) and the expression plasmid pET11d from Millipore Sigma (Burlington, Massachusetts).
-
bioRxiv - Immunology 2023Quote: ... commercially available plasmids (pCMV-Cas9-RFP and pCMV-Cas9-GFP) from Sigma-Aldrich was used targeting sequence AATACATACCGTCAGAAGCAGG in exon 3 of EIF2AK2 (PKR ...
-
bioRxiv - Immunology 2023Quote: ... and plasmid DNA was isolated using GenElute™ HP Maxiprep Kit (Millipore Sigma) following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with NF-κB Luciferase reporter plasmid using polyethylenimine (PEI, Sigma). The culture medium was refreshed 8 h post-transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... Free genomic and plasmid DNA was digested with a Benzonase Nuclease (Sigma-Aldrich). Cell debris was removed by centrifugation and ...
-
bioRxiv - Bioengineering 2023Quote: ... coli XL-I Blue transformants with the Sigma GenElute Plasmid Kit (Sigma-Aldrich) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... The Cre-recombined ROSA-Kaleidoscope plasmid and Fast Green FCF dye (MKCD1540, Sigma) were mouth-pipetted through glottis until embryonic lumens were visibly filled ...
-
bioRxiv - Molecular Biology 2023Quote: Cells were transfected with plasmid DNA using Gene Juice Transfection Reagent (Merck Millipore) 24 h after plating ...
-
bioRxiv - Cancer Biology 2023Quote: ... gag-pol and env plasmids using X-tremeGENE HP transfection reagent (Sigma, 6366236001). The supernatants were used to infect U2OS cells ...
-
Autophagy suppression in DNA damaged cells occurs through a newly identified p53-proteasome-LC3 axisbioRxiv - Cell Biology 2024Quote: ... and CdtC subunits (within pET-15b protein expression plasmids; #69661, Sigma-Aldrich, USA), each expressed with an amino-terminal polyhistidine fusion peptide ...
-
bioRxiv - Cell Biology 2024Quote: ... The plasmid mixture was added to 1mL of 278 uM CaCl2 (Sigma C1016) and mixed thoroughly before adding 1mL of 2x BBS solution [280 mM NaCl (Fisher Scientific S271-1) ...
-
bioRxiv - Genomics 2024Quote: ... and plasmid DNA was transfected into HEK293T cells using the PEI reagent (Sigma). After 48 h ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and follicle stimulating hormone (FSH) were determined using MILLIPLEX MAP Rat Pituitary Magnetic Bead Panel following manufacturer’s protocol (Merck-Millipore, Burlington, MA). Serum free fatty acids were measured using kits from Cell Biolabs ...
-
bioRxiv - Neuroscience 2021Quote: ... the rats were exposed to fruit odor (gas flowing through a bottle containing 0.5% amyl acetate liquid; Sigma-Aldrich, Helsinki, Finland) for 1 min (30 volumes) ...
-
bioRxiv - Cell Biology 2022Quote: Affinity-purified rabbit anti-AQP5 IgG antibody targeted towards amino acid residues 249-265 of rat AQP5 (AB15858) and normal goat IgG antibody (NI02-100UG) were obtained from Millipore Sigma. Normal rabbit IgG antibodies were obtained from Cell Signaling Technology (2729 ...
-
bioRxiv - Physiology 2020Quote: ... according to the manufacturer’s instructions (Mouse Leptin ELISA Kit, 90030; Crystal Chem, Zaandam, Netherlands; Rat/Mouse Insulin ELISA Kit, cat. EZRMI-13K; Merck Millipore). The intra- and interassay coefficients of variation (CVs ...
-
bioRxiv - Genetics 2019Quote: ... We used the anti-HA high affinity monoclonal antibody from rat to recognize the HA-peptide (clone 3F10, ref 11 867 423 001, Sigma-Aldrich).
-
bioRxiv - Pharmacology and Toxicology 2019Quote: Diabetes mellitus was induced in male Wistar rats by a single intraperitoneal injection of streptozotocin (STZ) (Sigma, St. Louis, MO, USA) at dose level of 45 mg /kg b.w ...
-
bioRxiv - Biophysics 2019Quote: The DNA sequence encoding for the ARD of rat TRPV1 (residues 100-262) was cloned into a pET28c vector (Merck-Millipore, USA). For expression ...
-
bioRxiv - Developmental Biology 2019Quote: Single cell suspensions of wild type AGM and YS at E9.5 and E11.5 were stained with rat anti-mouse CD144-efluor660 1:200 (eBioscience #50-1441-82, clone eBIOBV13) and 7AAD (Sigma, #A9400). Cells were analyzed and sorted on FACSAria (BD) ...
-
bioRxiv - Biochemistry 2020Quote: ... on genomic DNA isolated from 3-week-old tissue-cultured plants as a template and then selected by northern blot analysis with a HT specific cDNA fragment as probe and subsequently by western blot analysis with antibodies specific to rat HT protein (Sigma-Aldrich).
-
bioRxiv - Biophysics 2021Quote: ... Adult male Wistar rats weighing 200 ± 20 g were given a single intraperitoneal injection of 60 mg/kg (of body weight) crotaline (Sigma-Aldrich) (dissolved in HCl and 140 mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... 1:500 dilution of Rat polyclonal anti-GnRH antibody (Skrapits et al., 2015) and 1:250 dilution Guinea Pig polycloncal anti-NeuN (EMD Millipore). After the brain slices were washed 3x with 1XPBS they were incubated with the following secondary antibodies in blocking buffer for 2 hours at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... Dissociated cortical neurons from E18 Sprague Dawley rat pups were plated on slips or plates coated with poly-D-lysine (Sigma, MO). For live imaging ...
-
bioRxiv - Neuroscience 2021Quote: ... mechanically dissociated cortices from P1-3 Wistar rats were cultured in poly-D-lysine (PDL)-coated (10 μg/mL; Sigma P7886) tissue culture plates (diameter 10 cm ...
-
bioRxiv - Neuroscience 2020Quote: ... The hydrolyzed TMOS (100 μl) was added to 900 μl of 10 μM of pooled siRNA against rat FL2 (siRNA from Sigma-Aldrich: SASI_Rn02 00314854 ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were incubated for 1 hr in blocking solution (PBS with 0.5% Triton X-100 and 5% goat serum) at RT followed by rat monoclonal anti-SST primary antibody (1:100; MAB354, Sigma-Aldrich) for at least 12 hr at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... USA) encoding TAT-naked mole rat calmodulin (TAT-NMR-CaM) cloned into NdeI and BamHI sites in pET19b (EMD Millipore, USA) with an in-frame stop codon prior to the BamHI site ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were incubated overnight at 4 °C with the respective primary antibodies (rat-monoclonal anti- BrdU −1:200- Abcam; Rabbit polyclonal antibody anti-DCX,1:500- Cell Signaling; mouse monoclonal anti-NeuN- Millipore) diluted in a 0.1 % BSA and 0.125 % Triton X-100 solution ...