Labshake search
Citations for Millipore Sigma :
1751 - 1800 of 10000+ citations for 6 chloro 4 methyl benzo b thiophene 3 o since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: When the tumor sizes reached to 80 mm3 animals were treated with a PFKFB3 inhibitor 3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one) (3PO) (Sigma-Aldrich, Merck, Overijse, Belgium). The animals received intraperitoneal (i.p. ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... human recombinant MAO-A (hMAO-A) and MAO-B (hMAO-B) enzymes (Sigma-Aldrich) were diluted in 50 mM phosphate buffer (final protein amount ...
-
bioRxiv - Microbiology 2022Quote: ... purified bacterial cultures (B. adolescentis and B. fragilis at 107CFU/ml) or putrescine (Sigma) diluted to final concentrations of 33/66/100mM ...
-
bioRxiv - Molecular Biology 2022Quote: ... Oocytes were mounted in VectaShield containing 0.75 μg/ml 4-6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich, D9542). Imaging was performed using a Zeiss Axio Observer Z1 microscope with AxioCam MRm Rev3 camera and ApoTome optical sectioning (Carl Zeiss ...
-
bioRxiv - Neuroscience 2021Quote: ... The sections were counterstained with 5 μM 4’,6-diamidine-2’-phenylindole dihydrochloride (DAPI) (Sigma-Aldrich, Cat# D9542) in PBS ...
-
bioRxiv - Developmental Biology 2020Quote: ... the nuclei were labeled with a 1:10,000 dilution of DAPI (4’,6-Diamidino-2-phenylindole; Sigma, D9542) in PBS ...
-
bioRxiv - Cell Biology 2019Quote: ... DNA staining was achieved by addition of 1 μg/ml 4',6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich). Coverslips were mounted using mounting medium (20 mM Tris pH8 ...
-
bioRxiv - Microbiology 2021Quote: ... Sections were counterstained with 4′,6-Diamidino-2-phenylindole di-hydrochloride (DAPI, Sigma-Aldrich, St. Louis, MO, USA) diluted 1:3.000 in PBS ...
-
bioRxiv - Plant Biology 2021Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich catalogue no D9542, 1:600 dilution). Figure 4 shows images of seedlings from 1 of 6 experiments ...
-
bioRxiv - Pathology 2021Quote: ... and then they were incubated with 100 ng/ml 4′,6-Diamidine-2′-phenylindole dihydrochloride (DAPI; Sigma-Aldrich) in PBS before mounting with ImmunoSelect antifading mounting medium (Dianova) ...
-
bioRxiv - Cell Biology 2020Quote: ... nuclei were stained by addition of 1 µg/mL 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Sigma-Aldrich) containing FluoromountG (Southern Biotech) ...
-
bioRxiv - Neuroscience 2022Quote: ... the sections were treated with PBS containing 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Sigma-Aldrich, cat# D8417) for 20 min and mounted with cover glass using Fluorogel (Electron Microscopy Sciences ...
-
bioRxiv - Cancer Biology 2022Quote: ... the cover slides were treated with 1 mg/ml N-sulfosuccinimidyl-6-(4′-azido-2′-nitrophenylamino) hexanoate (Sigma) and exposed to ultra-violet (UV ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then treated with 4′,6-Diamidine-2′-phenylindole dihydrochloride at 15mM (DAPI, Sigma-Aldrich, Madrid, Spain) during 15 minutes at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: ... at RT and nuclear counterstaining was performed using 4’,6-diamidino-2-phenylindole (DAPI, 1.5 μg/mL; Sigma). After brief drying ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by staining with 4’,6-diamidino-2-phenylindole (DAPI, 1:10,000 dilution with milliQ water, Sigma-Aldrich) for 10 minutes ...
-
bioRxiv - Neuroscience 2019Quote: Zebrafish 4-6 dpf larvae were immobilized right side up in 2% low melting point agarose (Sigma-Aldrich) on microscope slides ...
-
bioRxiv - Genomics 2019Quote: ... Cells were also labelled with a combination of 4′,6-diamidino-2-phenylindole or DAPI (Sigma, Cat #D9542) and Wheat Germ Agglutinin (WGA ...
-
bioRxiv - Developmental Biology 2019Quote: ... followed by appropriate fluorescently conjugated secondary antibodies and counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Sigma, D9542). Primary antibodies used were against ...
-
bioRxiv - Physiology 2020Quote: ... Nuclei were counter-stained with 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 1/5000) (Sigma-Aldrich, Dorset, UK). Imaging was performed on a Leica TCS SP5 confocal microscope (Leica Microsystems ...
-
bioRxiv - Microbiology 2021Quote: ... T13320), SYTOX green (0.25μM, Thermo, S7020) and 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI, 2μg/ml, Sigma, D9542). Staining was performed at ambient temperature for 20 minutes in the dark followed by a wash with 50μl PBS ...
-
bioRxiv - Immunology 2020Quote: Cell suspensions were stained for viability with either 1:3000 4’,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich) or 1:1000 Zombie Aqua (Biolegend ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated for 5 min with 10 μg/ml 4’,6-Diamidino-2-phenylindole (DAPI; Sigma-Aldrich) to stain cell nuclei ...
-
bioRxiv - Neuroscience 2022Quote: ... with 1:30,000 of the fluorescent marker of nucleic acids 4’,6-diamino-2-fenilindol (DAPI; Sigma-Aldrich). We took photographs of the cells using an epifluorescence microscope (DMIL LED ...
-
bioRxiv - Molecular Biology 2022Quote: ... the nuclear pellet was resuspended in buffer C (40 mM HEPES pH 7.6, 4 mM MgCl2, 0.6% Triton X-100, 0.5% IGEPAL CA-630, 20% Glycerol, 1 mM DTT, Sigma cOmplete EDTA-free Protease Inhibitor Cocktail ...
-
bioRxiv - Cancer Biology 2022Quote: ... Coverslips were lastly counterstained with DAPI (4′,6-diamidino-2-phenylindole) and mounted on slides using DABCO (Sigma). Cells were then viewed using a Nikon Ti2-E/A1R-Multiphoton microscope equipped with DS-Qi2 camera (Nikon).
-
bioRxiv - Microbiology 2022Quote: ... Nuclei were labeled using 4′,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich, catalog no. D9542, 100 ng/ml).
-
bioRxiv - Immunology 2022Quote: Dissected thymus lobes from C57BL/6 mice were cleaned of connective tissue and fixed in 4% paraformaldehyde (Sigma) for 1 h at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were then treated with 4′,6-Diamidine-2′-phenylindole dihydrochloride at 15mM (DAPI, Sigma-Aldrich, Madrid, Spain) during 15 minutes at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... CD1 male (n=10 per group) mice between the ages of 4-6 weeks were given tamoxifen (Sigma) in peanut oil ...
-
bioRxiv - Molecular Biology 2024Quote: Cells were cultured in 6-well plates to the appropriate density and fixed with 4% paraformaldehyde (Sigma-Aldrich) for 15 min and then permeabilized with 0.02% Triton X-100 for 5 min at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... were used as secondary antibodies and sections were counterstained with 4′,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich). Mounting was performed using Prolong Gold Antifade Mountant (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) 1:1,000 (Sigma-Aldrich Sweden AB, Stockholm, Sweden). Invasion of the cells was measured by counting the nuclei of the cells that migrated through the filter pores towards the chemoattractant (6% FBS) ...
-
bioRxiv - Cancer Biology 2024Quote: T1D was induced in 4-6 hrs fasted mice by intraperitoneal (i.p.) injection of low dose streptozotocin (Millipore) at 50 mg/kg for five consecutive days ...
-
bioRxiv - Microbiology 2023Quote: ... Nuclei were labeled using 4′,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich, catalog no. D9542, 100 ng/ml). The immunostained lymph node tissues were scanned using an Olympus VS-120 slide scanner with a Hamamatsu ORCA-R2 C10600 digital camera ...
-
bioRxiv - Molecular Biology 2023Quote: ... and incubated in blocking buffer containing 0.8 μg/ml DAPI (4’,6-diamidino-2-phenylindole, Sigma, cat # D9542) for 1 h ...
-
bioRxiv - Microbiology 2023Quote: ... The plate was then rinsed with PBS and counter-stained with 4′,6-diamidino-2-phenylindole DAPI (Sigma) for 15 min ...
-
bioRxiv - Bioengineering 2023Quote: ... Sections were incubated with DAPI (4’,6-Diamidino-2-phenylindole dihydrochlorid) solution(D9542, Sigma-Aldrich, diluted 1:10000) for 7 minutes at RT and subsequently mounted in ProLong Gold Antifade mounting medium (cat ...
-
bioRxiv - Genetics 2023Quote: ... were used as secondary antibodies and sections were counterstained with 4′,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich). Mounting was performed using Prolong Gold Antifade Mountant (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Samples were then incubated in the DNA fluorescent stain DAPI (4’,6-diamidino-2-phenylindole; Sigma-Aldrich, D9542) at a concentration of 1 µg/ml in 1x PBS for 30 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) and mounted in Mowiol (Sigma-Aldrich, MO, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The plate was then rinsed with PBS and counter-stained with 4′,6-diamidino-2-phenylindole DAPI (Sigma) for 15 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were untreated or treated with 100 nM 2-chloro-N6-cyclopentyadenosine (CCPA) (Sigma-Aldrich, St. Louis, Missouri, United States) for 30 min for CCPA only group ...
-
bioRxiv - Cancer Biology 2023Quote: ... staining solution (0.3 mg/ml of 5-bromo4-chloro-3indolyl β-D-galactoside, X-Gal Fermentas R0401, 40 mM citric acid, Sigma C-0759 ...
-
bioRxiv - Immunology 2024Quote: ... 8-Cyclopentyl-1,3-dipropylxanthine (DPCPX)(28, 33, 34) or A1 receptor agonist 2-Chloro-N6-cyclopentyladenosine (35) were purchased from Sigma Aldrich, dissolved in DMSO and filter sterilized by passing through a 0.22μm filter prior to use ...
-
bioRxiv - Molecular Biology 2023Quote: ... Exponentially growing RPE-1 (human retinal pigment epithelial) cells were pulse-labeled with CldU (5-Chloro-2’-deoxyuridine, Millipore Sigma) and IdU (5-Iodo-2’-deoxyuridine ...
-
bioRxiv - Molecular Biology 2023Quote: ... the cells were washed four to five times with warm media (DME-HG for MEFs and DME-HG/F12 for MCF10A) and pulse-labeled with 100 µM 5- chloro-2’-deoxyuridine (CldU; Sigma) for 20 min at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: The mice received three injections every 2 h (200 ul/injection, intraperitoneally in alternative sites of the body) of 5-Chloro-2’-deoxy-Uridine (CldU, Sigma reference C6891 ...
-
bioRxiv - Immunology 2021Quote: ... shCASP8-B (Sigma SHCLND, TRCN0000376481): GGAGCTGCTCTTCCGAATTAA ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.540g B glycerophosphate (Sigma G9422), 0.092g Na3VO4 (Sigma 450243) ...