Labshake search
Citations for Millipore Sigma :
1651 - 1700 of 10000+ citations for 6 chloro 4 methyl benzo b thiophene 3 o since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2021Quote: ... and then they were incubated with 100 ng/ml 4′,6-Diamidine-2′-phenylindole dihydrochloride (DAPI; Sigma-Aldrich) in PBS before mounting with ImmunoSelect antifading mounting medium (Dianova) ...
-
bioRxiv - Cell Biology 2020Quote: ... nuclei were stained by addition of 1 µg/mL 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Sigma-Aldrich) containing FluoromountG (Southern Biotech) ...
-
bioRxiv - Neuroscience 2022Quote: ... the sections were treated with PBS containing 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Sigma-Aldrich, cat# D8417) for 20 min and mounted with cover glass using Fluorogel (Electron Microscopy Sciences ...
-
bioRxiv - Cancer Biology 2022Quote: ... the cover slides were treated with 1 mg/ml N-sulfosuccinimidyl-6-(4′-azido-2′-nitrophenylamino) hexanoate (Sigma) and exposed to ultra-violet (UV ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then treated with 4′,6-Diamidine-2′-phenylindole dihydrochloride at 15mM (DAPI, Sigma-Aldrich, Madrid, Spain) during 15 minutes at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: ... at RT and nuclear counterstaining was performed using 4’,6-diamidino-2-phenylindole (DAPI, 1.5 μg/mL; Sigma). After brief drying ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by staining with 4’,6-diamidino-2-phenylindole (DAPI, 1:10,000 dilution with milliQ water, Sigma-Aldrich) for 10 minutes ...
-
bioRxiv - Neuroscience 2019Quote: Zebrafish 4-6 dpf larvae were immobilized right side up in 2% low melting point agarose (Sigma-Aldrich) on microscope slides ...
-
bioRxiv - Genomics 2019Quote: ... Cells were also labelled with a combination of 4′,6-diamidino-2-phenylindole or DAPI (Sigma, Cat #D9542) and Wheat Germ Agglutinin (WGA ...
-
bioRxiv - Developmental Biology 2019Quote: ... followed by appropriate fluorescently conjugated secondary antibodies and counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Sigma, D9542). Primary antibodies used were against ...
-
bioRxiv - Physiology 2020Quote: ... Nuclei were counter-stained with 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 1/5000) (Sigma-Aldrich, Dorset, UK). Imaging was performed on a Leica TCS SP5 confocal microscope (Leica Microsystems ...
-
bioRxiv - Microbiology 2021Quote: ... T13320), SYTOX green (0.25μM, Thermo, S7020) and 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI, 2μg/ml, Sigma, D9542). Staining was performed at ambient temperature for 20 minutes in the dark followed by a wash with 50μl PBS ...
-
bioRxiv - Immunology 2020Quote: Cell suspensions were stained for viability with either 1:3000 4’,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich) or 1:1000 Zombie Aqua (Biolegend ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated for 5 min with 10 μg/ml 4’,6-Diamidino-2-phenylindole (DAPI; Sigma-Aldrich) to stain cell nuclei ...
-
bioRxiv - Neuroscience 2022Quote: ... with 1:30,000 of the fluorescent marker of nucleic acids 4’,6-diamino-2-fenilindol (DAPI; Sigma-Aldrich). We took photographs of the cells using an epifluorescence microscope (DMIL LED ...
-
bioRxiv - Molecular Biology 2022Quote: ... the nuclear pellet was resuspended in buffer C (40 mM HEPES pH 7.6, 4 mM MgCl2, 0.6% Triton X-100, 0.5% IGEPAL CA-630, 20% Glycerol, 1 mM DTT, Sigma cOmplete EDTA-free Protease Inhibitor Cocktail ...
-
bioRxiv - Cancer Biology 2022Quote: ... Coverslips were lastly counterstained with DAPI (4′,6-diamidino-2-phenylindole) and mounted on slides using DABCO (Sigma). Cells were then viewed using a Nikon Ti2-E/A1R-Multiphoton microscope equipped with DS-Qi2 camera (Nikon).
-
bioRxiv - Microbiology 2022Quote: ... Nuclei were labeled using 4′,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich, catalog no. D9542, 100 ng/ml).
-
bioRxiv - Immunology 2022Quote: Dissected thymus lobes from C57BL/6 mice were cleaned of connective tissue and fixed in 4% paraformaldehyde (Sigma) for 1 h at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were then treated with 4′,6-Diamidine-2′-phenylindole dihydrochloride at 15mM (DAPI, Sigma-Aldrich, Madrid, Spain) during 15 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... Nuclei were labeled using 4′,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich, catalog no. D9542, 100 ng/ml). The immunostained lymph node tissues were scanned using an Olympus VS-120 slide scanner with a Hamamatsu ORCA-R2 C10600 digital camera ...
-
bioRxiv - Molecular Biology 2023Quote: ... and incubated in blocking buffer containing 0.8 μg/ml DAPI (4’,6-diamidino-2-phenylindole, Sigma, cat # D9542) for 1 h ...
-
bioRxiv - Microbiology 2023Quote: ... The plate was then rinsed with PBS and counter-stained with 4′,6-diamidino-2-phenylindole DAPI (Sigma) for 15 min ...
-
bioRxiv - Bioengineering 2023Quote: ... Sections were incubated with DAPI (4’,6-Diamidino-2-phenylindole dihydrochlorid) solution(D9542, Sigma-Aldrich, diluted 1:10000) for 7 minutes at RT and subsequently mounted in ProLong Gold Antifade mounting medium (cat ...
-
bioRxiv - Genetics 2023Quote: ... were used as secondary antibodies and sections were counterstained with 4′,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich). Mounting was performed using Prolong Gold Antifade Mountant (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Samples were then incubated in the DNA fluorescent stain DAPI (4’,6-diamidino-2-phenylindole; Sigma-Aldrich, D9542) at a concentration of 1 µg/ml in 1x PBS for 30 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... CD1 male (n=10 per group) mice between the ages of 4-6 weeks were given tamoxifen (Sigma) in peanut oil ...
-
bioRxiv - Molecular Biology 2024Quote: Cells were cultured in 6-well plates to the appropriate density and fixed with 4% paraformaldehyde (Sigma-Aldrich) for 15 min and then permeabilized with 0.02% Triton X-100 for 5 min at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... were used as secondary antibodies and sections were counterstained with 4′,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich). Mounting was performed using Prolong Gold Antifade Mountant (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) 1:1,000 (Sigma-Aldrich Sweden AB, Stockholm, Sweden). Invasion of the cells was measured by counting the nuclei of the cells that migrated through the filter pores towards the chemoattractant (6% FBS) ...
-
bioRxiv - Cancer Biology 2024Quote: T1D was induced in 4-6 hrs fasted mice by intraperitoneal (i.p.) injection of low dose streptozotocin (Millipore) at 50 mg/kg for five consecutive days ...
-
bioRxiv - Immunology 2021Quote: ... shCASP8-B (Sigma SHCLND, TRCN0000376481): GGAGCTGCTCTTCCGAATTAA ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.540g B glycerophosphate (Sigma G9422), 0.092g Na3VO4 (Sigma 450243) ...
-
bioRxiv - Cell Biology 2022Quote: ... Latrunculin B (L5288 from Sigma), 5µM ...
-
bioRxiv - Genomics 2019Quote: ... and B-actin (A5441, Sigma) were used at dilution 1:1000 and 1:5000 ...
-
bioRxiv - Genomics 2020Quote: ... 0.1mM b-mercaptoethanol (Sigma-Aldrich), 2mM L-glutamine (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2019Quote: ... amphotericin B (Sigma - Aldrich, Germany) (from 0.125 to 16 µg/mL) ...
-
bioRxiv - Cell Biology 2019Quote: ... Latrunculin B (Sigma, 5 µM) was added to the culture media for 10 min before 20 min of rapamycin ...
-
bioRxiv - Microbiology 2021Quote: ... and polymyxin B (Sigma-Aldrich), were serially diluted 1 in 2 ...
-
bioRxiv - Cell Biology 2021Quote: ... antifoam B (Sigma, 1:5000), and 40U/mL RNAsin (Promega)) ...
-
bioRxiv - Microbiology 2021Quote: ... 2.5μg/mL Polymyxin B (Sigma) was used as permeabilizing agent in the positive control ...
-
bioRxiv - Cell Biology 2021Quote: ... and 0.1% amphotericin B (Sigma). Spinner-adapted L929 cells (originally obtained from the Bernard Fields laboratory ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:5000 Antifoam B (Sigma) and lysed by vortexing with acid-washed glass beads for 2 min followed by 2 min on ice for three cycles ...
-
bioRxiv - Genomics 2022Quote: ... 0.1 mM b-mercaptoethanol (Sigma) and 1000 U/mL of LIF (Chemicon) ...
-
bioRxiv - Neuroscience 2021Quote: ... rhodamine B (RhoB; Sigma Aldrich), Rp-8-Br-PET-cGMPS ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by pestle B (Sigma), and filtered through a 70-um cell strainer (Fisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... b-actin (Sigma, AC-15), P-eIF2a (Abcam ...
-
bioRxiv - Developmental Biology 2019Quote: ... 200 nM b-mercaptoethanol (Sigma), 1 % sodium pyruvate (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... B-Actin (A1978; Sigma-Aldrich).
-
bioRxiv - Immunology 2020Quote: ... Amphotericin B (all Sigma-Aldrich), and BD Difco™ BBL™ Middlebrook ADC Enrichment and incubated at 37 °C with agitation with a magnetic stir bar ...