Labshake search
Citations for Millipore Sigma :
1701 - 1750 of 1800 citations for TMB Substrates since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... hydrated and stained for TRAP as follows: Substrate solution was prepared by adding 1 mL Ethylene Glycol Monoethyl Ether (E2632, Sigma-Aldrich) to 20 mg naphthol AS-MX phosphate (N4875 ...
-
bioRxiv - Microbiology 2023Quote: ... pestis KIM6+ outer membranes were examined by quantifying the β-lactamase activity as described previously (7) using the chromogenic substrate CENTA (Sigma). Briefly ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were seed on elastic cell culture substrates with defined stiffness (2, 15 or 100kPa) (ExCellness) coated with type I collagen (Sigma-Aldrich). Matrigel on top (MoT ...
-
bioRxiv - Biophysics 2023Quote: ... the substrates were kept in a hermetically sealed case with a 50-ml aliquot of liquid silane (3-aminopropyl triethoxysilane, Sigma-Aldrich) at 70 °C for 1 h ...
-
bioRxiv - Biochemistry 2022Quote: ... and activity was measured by the cleavage of the fluorogenic MMP Substrate MCA-Lys-Pro-Leu-Gly-Leu-DNP-Dpa-Ala-Arg-NH2 (Sigma-Aldrich). Normalized velocities were fitted in MATLAB Curve Fitting Toolbox (MathWorks ...
-
bioRxiv - Biochemistry 2023Quote: ... and Des4 was measured using a fluorogenic substrate Dnp-Pro-Leu-Gly-Leu-Trp-Ala-D-Arg-NH2 (Sigma-Aldridge, USA) in an enzyme activity buffer (50 mM HEPES ...
-
bioRxiv - Plant Biology 2023Quote: Proteasome activity was measured by spectrofluorometry using the 7-amino-4-methylcoumarin (AMC)-labeled fluorogenic substrate succinate-LLVY-AMC (Roche Sigma-Aldrich) in cleared extracts of leaf 1 at different dpg (Üstün and Börnke ...
-
bioRxiv - Microbiology 2023Quote: ... was added for 1h at RT followed by incubation with OPD substrate revealing reaction for 10 min (Sigma-Aldrich, MO, USA). Absorbances were analyzed at 495 vs 620 nm on an ELISA plate reader (Berthold ...
-
bioRxiv - Bioengineering 2023Quote: ... substrates were placed in the 6-well plates and they were coated with poly-l-lysine (PLL, Sigma-Aldrich, MO, USA) solution prepared in ddH2O ...
-
bioRxiv - Molecular Biology 2024Quote: ... Mitochondrial respiration was assessed by additions of substrates and inhibitors in the following order: pyruvate + glutamate + malate (5 mM each; # P8574, # G5889, # M7397; Sigma-Aldrich), ADP (1 mM ...
-
bioRxiv - Immunology 2024Quote: ... was used as secondary detection antibody incubated at 45 mins at 37°C before addition of para-nitrophenylphosphate substrate (Sigma Aldrich). Plates were read at an optical density (OD ...
-
bioRxiv - Bioengineering 2023Quote: ... ALP activity was quantified in supernatant by adding 100 μl substrate solution (10 mM p-nitrophenyl-phosphate (pNPP) (71768, Sigma-Aldrich), 0.15 M 2-amino-2-methyl-1-propanol (AMP ...
-
bioRxiv - Microbiology 2024Quote: ... Enzyme activity was determined spectrophotometrically by hydrolysis of chromogenic substrates like p- Nitrophenol acetate (pNP-acetate) and p-Nitrophenol butyrate (pNP-butyrate) (Sigma- Aldrich) as described by Singh et al. ...
-
bioRxiv - Plant Biology 2024Quote: 5 μg kinase OsDMI3-GST was incubated with 5 μg substrates (OsPrx20-His, Os Prx20T244A-His, or myelin basic protein [MBP; Sigma-Aldrich]) in kinase reaction solution for 30 min as described previously (Shen et al. ...
-
bioRxiv - Immunology 2024Quote: ... Wells were then washed 6 times with PBS/T and developed with 100 µL of p-nitrophenyl phosphate substrate at 1 mg/mL (Sigma-Aldrich) and optical density read at 405 nm (OD405 ...
-
bioRxiv - Cancer Biology 2024Quote: Cells were seeded in a 96-well plate at a density of 15,000 cells per well in 50 µL of medium containing the HDAC substrate N-(4-Methyl-7-aminocoumarinyl)-Nα-(t-butoxycarbonyl)-Nω-acetyllysineamide (21 μM, MAL, Sigma-Aldrich) and incubated for 8 h at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... Secondary antibody solution was then washed out 3x with TBS-T and the membrane was exposed to Immobilon Western Chemiluminescent HRP Substrate (EMD Millipore Sigma) for ~60 s prior to imaging on a Bio-Rad ChemiDoc XRS+ using detection settings appropriate for the band intensity of each analyte.
-
bioRxiv - Molecular Biology 2021Quote: Extracellular Gus activity was determined to quantify unconventional Cts1 secretion using the specific substrate 4-methylumbelliferyl ß-D galactopyranoside (MUG, Sigma–Aldrich). Cell-free culture supernatants were mixed 1:1 with 2x Gus assay buffer (10 mM sodium phosphate buffer pH 7.0 ...
-
bioRxiv - Cell Biology 2019Quote: ... The membrane was then rinsed three times with TBST and visualized with UV lighting after applying the chemiluminescent substrate to the membrane (EMD Millipore #WBLUF0100).
-
bioRxiv - Bioengineering 2021Quote: ... Positive controls (SFN) were obtained by incubating spin-coated PLLA substrates with fibronectin (100 μg mL−1) from bovine plasma-solution (Sigma-Aldrich, F1141).
-
bioRxiv - Biochemistry 2020Quote: ... upon energization with the substrate glutaryl-CoA (15 μM) in the presence of the phenazine methosulfate (PMS, 2 mM, Millipore-Sigma # P9625) mediator ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were washed a further three times in TBS-T prior to antibody detection using enhanced chemiluminescence horseradish peroxidase substrate detection kit (Millipore, Hertfordshire, UK). Imaging was undertaken using a G:BOX Chemi-XR5 (Syngene ...
-
bioRxiv - Physiology 2021Quote: ... All incubations with primary antibodies were performed for 16 hours at 4°C. Blots were developed using SuperSignal West Pico (Pierce, Ref. 34580) or Luminata Forte Western HRP substrate (Merck Millipore, Ref. WBLUF0500).
-
bioRxiv - Microbiology 2020Quote: The fluorescent substrate MUC was applied for the Cts1 liquid assay (4-methylumbelliferyl β-D-N,N′,N′′-triacetylchitotrioside hydrate; M5639 Sigma-Aldrich) (Koepke et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... The development was performed in an ImageQuant™ LAS 500 Ge Life Sciences apparatus (Piscataway, NJ, USA) using the appropriate substrate of peroxidase (Luminata™Forte, Merck Millipore). The reaction was conducted in the dark ...
-
bioRxiv - Biophysics 2020Quote: ... 304 μL BPTI (4 different concentrations ranging from 5.2 to 52.6 μM) was mixed with 8 μL of the substrate Z-GPR-pNA (Sigma-Aldrich, St. Louis, MO) (5 different concentrations ranging from 0.4 to 10 mM) ...
-
bioRxiv - Genetics 2022Quote: ... Incubation with appropriate secondary HRP-labelled antibody (less than 1h) was followed by detection with Immobilon western chemiluminescent HRP substrate (Merck Millipore, Darmstadt, Germany).
-
bioRxiv - Molecular Biology 2022Quote: ... rinsed with PBS and the proteins were visualized with Immobilon Western Chemiluminiscent HRP substrate (Merck/Millipore, used at 1:1:3 (H2O) dilution ...
-
bioRxiv - Biochemistry 2020Quote: ... cell lysates were diluted 10-fold and incubated with substrate (5 mM α-naphthyl phosphate, Sigma-Aldrich N7255, dissolved in assay buffer) at 30°C for 20 min ...
-
bioRxiv - Neuroscience 2019Quote: ... After washing the membrane pieces 3 times for 20 min with TBST and 20 min with TBS membrane was incubated in Immobilon Western chemiluminescent HRP substrate (Millipore, cat# WBKLS0500) for 5 min ...
-
bioRxiv - Neuroscience 2021Quote: ... membranes were washed three times with TBS-T and developed in a chemiluminescence system (Fusion FX Vilber Lourmat, Vilber, France) using chemiluminescent HRP substrate (Millipore, MA, USA). Intensities of specific bands were normalized to a protein loading control or to the total protein levels marked using MemCode™ Reversible Protein (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... Membranes were washed three more times in TBS-T before antibody detection using enhanced chemiluminescence horseradish peroxidase substrate detection kit (Millipore, Hertfordshire, UK). Imaging was conducted using a G:Box Chemi-XR5 (Syngene ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the reaction mixture consisted of 125 µl of 55 mM phosphate buffer adjusted to pH 7 and 10 µl of the substrate 1 mM ρ-nitrophenyl butyrate (PNPB) (Sigma N9876) homogenised in 2-propanol ...
-
bioRxiv - Systems Biology 2019Quote: ... were conducted with 200-500 pmol of each pppXGGCUCGAACUUAAUGAUGACG oligo as RNA substrate in the same fashion except that [15N5]-GTP (Sigma Chemical Co.) was used instead of GTP in the VCS reaction step ...
-
bioRxiv - Microbiology 2021Quote: ... The membranes were washed three times with PBS-T at 4°C and the specific proteins were visualized with a chemiluminescence HRP substrate system (Millipore, Massachusetts, USA) using LAS 4000 (Fujifilm Life Science ...
-
bioRxiv - Plant Biology 2020Quote: ... Detection was performed by adding 200 μl of western blue substrate (SIGMAFAST™ BCIP®/NBT = 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium, Sigma) followed by incubation at room temperature in a dark and moist environment until the reagent’s color became visible ...
-
bioRxiv - Bioengineering 2020Quote: The secreted proteins from different strains were analyzed for cellulase and -mannanase activity as well as reducing sugar yield at three different condition of temperature (30°C, 40°C and 50°C) using carboxymethyl cellulose or locust bean gum as a substrate (Sigma-Aldrich Co.). The activity assay was determined by using 3,5-dinitrosalicylic acid (DNS ...
-
bioRxiv - Cell Biology 2020Quote: ... As a positive control we used a bona fide Src substrate peptide corresponding to amino acids 6-20 of p34cdc2 (Millipore-Sigma, 12-140). The reactions were carried out at room temperature in a total volume of 25 μL for 40 min in white 96-well ...
-
bioRxiv - Bioengineering 2022Quote: ... The reaction was started by adding 30 µL of 100 mM (final concentration 5 mM) substrate 4-nitrophenyl β-D-glucopyranoside (Sigma-Aldrich). At regular five-minute intervals ...
-
bioRxiv - Biochemistry 2022Quote: ... using the absorbance measurement of 2,2′-Azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (ABTS) substrate at 405 nm (Sigma Aldrich Catalog # 11468120910).
-
bioRxiv - Immunology 2022Quote: ... conjugated with horseradish peroxidase (HRP), (KPL, MD, USA) was used as secondary antibody and detected by chemiluminescence substrate (Immobilon western, Millipore, CA, USA) then exposed to an X-ray film ...
-
bioRxiv - Molecular Biology 2022Quote: Gus activity was determined to quantify chitin binding of Gus-Cts1 using the specific substrate 4-methylumbelliferyl β-D galactopyranoside (MUG, Sigma–Aldrich). To his end 50 μg of U ...
-
bioRxiv - Molecular Biology 2024Quote: Cathepsin L from human liver and the fluorogenic peptidomimetic substrate Z-Phe-Arg7-amido-4-methylcoumarin hydrochloride (Z-FR-AMC) were purchased from SIGMA (#219402, #C9521). The Cathepsin L enzyme buffer consisted of 50 mM Tris pH 6.5 ...
-
bioRxiv - Cell Biology 2024Quote: ... separated by SDS PAGE and immunoblotted with either anti-phospho-PKA substrate antibody (Cell Siginaling Technology, # 9621) or anti-Tns3 (Millipore Sigma, HPA055338).Ten µg of whole cell extract proteins were used for lysate controls ...
-
bioRxiv - Microbiology 2023Quote: ... Horseradish peroxidase-conjugated secondary antibodies (anti-mouse or anti-rabbit, at dilution 1:10000) and Immobilon® Western Chemiluminescent HRP substrate (Merk Millipore, Sigma Aldrich) were used to visualize FLAG-FlaA/FlaB and untagged FlaA/FlaB.
-
bioRxiv - Neuroscience 2023Quote: ... glia were plated on micro-islands of growth permissive substrate (mix of collagen I and poly-D-lysine, Corning 354236 and Sigma P6407, respectively) that were printed on a layer of 0.15% agarose.
-
bioRxiv - Cancer Biology 2023Quote: ... and chemiluminescent HRP substrates (Supersignal West Pico PLUS, Thermo Fisher Scientific; Pierce ECL Plus, Thermo Fisher Scientific; or Immobilon ECL Ultra, Millipore) (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... 100 ng purified recombinant CTR1-KD or 1 µg MPK4 was mixed with 2 µg Myelin Basic Protein (MBP, a common kinase substrate, Sigma Cat. M1891) and 1 mM ATPγS in kinase reaction buffer (10 mM HEPES pH 7.4 ...
-
bioRxiv - Cell Biology 2023Quote: ... TBS-T was used for washing the membranes. Membranes were developed using SuperSignal West Pico (Pierce, Ref. 34580) or Luminata Forte Western HRP substrate (Merck Millipore, Ref. WBLUF0500).
-
bioRxiv - Biophysics 2023Quote: ... We washed the membrane 3 times with TBST before incubating with a 1:1 ratio of horseradish peroxidase substrate and enzyme mixture (Millipore, Burlington, Massachusetts). We imaged using a Biorad Chemidoc camera set to detect chemiluminescence ...