Labshake search
Citations for Millipore Sigma :
1651 - 1700 of 10000+ citations for Tetratricopeptide Repeat Protein 5 TTC5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... 5 μg human insulin mL−1 and 5×10−7 M hydrocortisone hemisuccinate (Sigma). As a control we generated HepaRG cells expressing an inactive HBx null mutant (HepaRG-HBxSTOP ...
-
bioRxiv - Cell Biology 2021Quote: ... 100 ng/μL NGF and 40 μM 5-UfDU (uridine and 5-fluorodeoxyuridine, Sigma). Cultures were maintained at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... then treated with 1 uM of 5-Aza-2-deoxycytidine (5 –Aza, SIGMA, A3656) or PBS for 4 days ...
-
bioRxiv - Genetics 2022Quote: ... was diluted in molecular biology-grade water and 5-fluorouracil (5-FU) (Sigma-Aldrich) diluted in dimethyl sulfoxide (SigmaAldrich) ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2.with a mixture of 5 μg/mL polybrene (Sigma TR-1003-G) and pseudovirus diluted to a titer that produces 1*108 total integrated intensity units/mL ...
-
bioRxiv - Microbiology 2021Quote: ... media was supplemented with 50 mg L−1 5-aminolevulinic acid (5-ala, Sigma). When appropriate ...
-
bioRxiv - Microbiology 2021Quote: ... Top2β: Forward primer 5’CAGCCCGAAAGACCTAAATAC and reverse primer 5’ATCTAACCCATCTGAAGGAAC obtained from Sigma-Aldrich.
-
bioRxiv - Microbiology 2021Quote: ... and 5 g glucose) with 5 μl Penicillin-Streptomycin Stabilized solution (Sigma-Aldrich, P4458) and 24 μl of Amphotericin B solution (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of 5 mM Nicotinamide 1,N6-ethenoadenine dinucleotide (εNAD, Sigma cat # N2630) solution were added to each well immediately prior to the beginning of measurements and mixed by pipetting to reach a concentration of 500 μM in the 50 μl final volume reaction ...
-
bioRxiv - Cancer Biology 2022Quote: ... fish were incubated for 5 min with 5 mg.ml-1 adrenaline (epinephrine, Sigma, E4642) in order to contract the pigment in melanocytes prior mounting in LMP for imaging ...
-
bioRxiv - Neuroscience 2023Quote: ... the following 5-HTR antagonists were used: WAY100635 (W108, Sigma-Aldrich; for 5-HT1AR), GR55562 (cat# 1054 ...
-
bioRxiv - Cell Biology 2024Quote: ... or pre-treated for 5 min and then incubated with 5 mM succinate (Sigma), or both in combination ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl of 5 mM nicotinamide 1,N6-ethenoadenine dinucleotide (εNAD+, Sigma cat# N2630) was added to each well immediately before measurements ...
-
bioRxiv - Bioengineering 2023Quote: ... 5-Aminolevulinic acid hydrochloride >98% (5-ALA) (Sigma Aldrich, St. Louis, Missouri, United States) was used for cell dosing alongside standard GBM media ...
-
bioRxiv - Biochemistry 2023Quote: ... Disodium salts of nucleoside-5’-monophosphates (5’-NMPdss) were purchased from Sigma-Aldrich (Bangalore). All other reagents were purchased from Sigma-Aldrich and were of alalytical grade.
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM 2-amino-5-phosphonopentanoic acid and 100 U/ml DNase (DN25, Sigma) for 25 min ...
-
bioRxiv - Microbiology 2023Quote: ... low = 5 X 105 parasites) or concanamycin A (CON A) (5 μg/ml, Sigma); supernatants were harvested at 72 h ...
-
bioRxiv - Immunology 2023Quote: ... 5 ml of PBS and 5 ml of 4% Dextran (Sigma-Aldrich, 31392-50G) in PBS (Gibco ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 μM diphenyleneiodonium chloride (DPI) (Millipore-Sigma, D2926, resuspended to 5 mM in DMSO) in Hanks Balanced Salt Solution (HBSS ...
-
bioRxiv - Cancer Biology 2023Quote: ... for 5 min and blocked in 5% FBS (Sigma Aldrich, cat. no. F7524-500ml), 0.1% Triton™ X-100 ...
-
Nucleolar Pol II interactome reveals TBPL1, PAF1, and Pol I at intergenic rDNA drive rRNA biogenesisbioRxiv - Molecular Biology 2023Quote: ... the cells were exposed to 1 mM 5-fluorouracil (5-FU; Sigma, Cat# F5130) for 15 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... Following concentration ranges were tested: 100–0.1 µM for 5-fluorouracil (5-FU, Sigma), alpelisib (Biozol ...
-
bioRxiv - Microbiology 2020Quote: ... protein complexes were precipitated using Protein A agarose beads (Sigma, St. Louis, MO, USA). The precipitated material was analyzed by western blot ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: The protein content was analysed with the Bicinchonic Acid Protein Assay Kit (Sigma-Aldrich) according to the manufacturer’s protocol with minor adjustments ...
-
bioRxiv - Cell Biology 2021Quote: The Protein A slurry was prepared by washing 1.5 g Protein A Sepharose (Sigma) 4 times in 1X Tris Buffered Saline (1X TBS ...
-
bioRxiv - Neuroscience 2021Quote: ... Bradford protein assay was used to quantify total protein levels (Bradford, Sigma-Aldrich, USA) and to normalize BDNF data.
-
bioRxiv - Physiology 2022Quote: ... Protein carbonylation was assessed with an Oxyblot protein oxidation detection kit (#S7150, Merck Millipore) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Protein precipitation was carried out using ProteoExtract Protein Precipitation Kit (EMD Millipore, 539180-1KIT) according to the manufacturer’s protocol and submitted for MS analysis to the Taplin Biological Mass Spectrometry Facility.
-
The CB1 receptor interacts with cereblon and drives cereblon deficiency-associated memory shortfallsbioRxiv - Neuroscience 2023Quote: ... Bound proteins were captured with Protein G agarose for 4 h (Sigma-Aldrich, #17061801), spun at low speed ...
-
bioRxiv - Cell Biology 2023Quote: ... and total (i.e. nonphosphorylated) protein levels were normalized to tubulin protein levels (Sigma-Aldrich, #T6557 ...
-
bioRxiv - Molecular Biology 2024Quote: Total carbonylated proteins were quantified using OxyBlot Protein Oxidation Detection Kit (Millipore, Billerica, MA) following manufacturer’s instructions using 15 μg of total protein detected with rabbit anti-DNP antibodies (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... 500 μg of protein were added to washed agarose protein A beads (Merck Millipore) and incubated on a rotating wheel for 1 h at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... and visualized using InstantBlue Coomassie Protein Stain or ReadyBlue Protein Gel Stain (Sigma Aldrich).
-
bioRxiv - Microbiology 2020Quote: ... 5 μg/mL Insulin (Sigma), 10 ng/mL EGF (Sigma) ...
-
bioRxiv - Microbiology 2020Quote: ... 5% (Sigma, catalog # S-5761).
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM ATP (A2383, Sigma), 1 mM tris(2-carboxyethyl)phosphine (TCEP ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% Kolliphor HS-15 (Sigma) and 90% saline and delivered by intraperitoneal injection daily ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 mM pyruvate (Sigma-Aldrich) and 0.56 μL ml-1 NaOH (1M) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 mM Trolox (Sigma-Aldrich), and 10 mM sodium azide (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... containing 5% horse serum (Sigma), EGF (20ng/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... 5% formamide (Sigma-Aldrich #F9037), 0.5x SSC (75 mM NaCl ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 μg/ml insulin (Sigma), 50 μg/ml gentamicin (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5% BSA (A4503, Sigma) for one hour at RT ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 ng/mL EGF (Sigma), 3 ng/mL mFGF2 (R&D Systems) ...
-
bioRxiv - Immunology 2021Quote: ... 5 μg/ml insulin (Sigma) and 0.05 mM β-mercaptoethanol (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... 5 μg/mL kanamycin (Sigma) and 250 ng/mL amphotericin B (Sigma ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1mM 5-Ethynyluridine (Sigma Aldrich) was added to the culture medium and the plate was incubated for 2 hours ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μM sunitinib malate (Sigma), or 5 μM ISCK03 (Sigma).
-
bioRxiv - Cancer Biology 2020Quote: ... or 5 μM ISCK03 (Sigma).
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μM imatinib mesylate (Sigma), 5 μM sunitinib malate (Sigma) ...