Labshake search
Citations for Millipore Sigma :
1601 - 1650 of 10000+ citations for Tetratricopeptide Repeat Protein 5 TTC5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... Protein extracts were performed with the Plant Total Protein Extraction Kit (Sigma, USA). Protein concentrations were measured using the BCA method ...
-
bioRxiv - Cancer Biology 2019Quote: ... Lysates were sonicated and protein concentration was determined using BCA protein assay (Sigma). 30 μg of total proteins were loaded on 12% SDS–PAGE gel and separated by electrophoresis ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... a marker of protein oxidation (protein carbonyls; OxyBlot; s7150; EMD Millipore, Billerica, MA), and a marker of mitochondrial biogenesis (PGC-1α ...
-
bioRxiv - Plant Biology 2020Quote: ... were subjected to protein extraction using Plant Total Protein Extraction Kit (Sigma-Aldrich). The protein concentration was measured using 2-D Quant Kit (GE Healthcare ...
-
bioRxiv - Genomics 2019Quote: Duolink PLA kit was used to detect protein-protein interactions (Sigma Aldrich DUO92101). PLA was performed according to manufacturer’s protocol plus additional negative controls ...
-
bioRxiv - Genetics 2020Quote: ... Protein concentrations were analyzed with a Bicinchoninic Acid Protein Assay Kit (Sigma-Aldrich), using bovine serum albumin as a standard ...
-
bioRxiv - Immunology 2020Quote: Total proteins isolated from BMDCs were lysed in CytoBuster protein extraction reagent (Novagen). Protein quantification was performed using NanoDrop One Spectrophotometer ...
-
bioRxiv - Cell Biology 2022Quote: ... the other stained for proteins with SYPRO Red Protein Gel Stain (Sigma Aldrich). Both dyes were used according to the manufacturers’ protocols.
-
bioRxiv - Molecular Biology 2024Quote: The protein mixtures were filtered using a low protein binding filter (Millipore Sigma) and purified on a SourceQ15 anion exchange column (Cytiva ...
-
bioRxiv - Genetics 2024Quote: ... protein concentration was measured by use of a BCA Protein Assay (SIGMA Aldrich) and samples stored at -80°C.
-
bioRxiv - Genomics 2024Quote: ... Protein transfer and total protein content was assessed by Ponceau Staining (Sigma Aldrich). Ponceau Stain was washed out with 1x TBST ...
-
bioRxiv - Microbiology 2022Quote: ... total cell protein was measured using the bicinchoninic acid protein assay (Sigma-Aldrich) against bovine serum albumin standards ...
-
bioRxiv - Microbiology 2023Quote: ... or with slurry protein G beads (Sigma-Aldrich Fast Flow Protein G sepharose). For GFP-p65 and GFP-COMMD2 the samples were immunoprecipitated as per manufacturer’s instructions with the elution was recovered in either 5x with Laemmli buffer 74 and boiled at 98°C (dry bath ...
-
bioRxiv - Microbiology 2023Quote: ... 1000 µg of protein extracts were cleared with agarose protein A beads (Millipore) at 4 ℃ for 1.5 h on a rocking platform ...
-
bioRxiv - Plant Biology 2023Quote: ... the protein extract was incubated with 30 μL Protein A Agarose beads (Millipore), 10 μL anti-SIZ1 antibody with rotation at 4°C for 4 h.
-
bioRxiv - Microbiology 2023Quote: ... The protein was purified using a Protein A agarose gravity column (Millipore Sigma) followed by SEC using a S200 column.
-
bioRxiv - Cancer Biology 2023Quote: Oxidized proteins were detected using the OxyBlot Protein Oxidation Detection Kit (Sigma, S7150) and following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein concentrations were determined with the BCA protein assay kit from Sigma-Aldrich.
-
bioRxiv - Neuroscience 2023Quote: ... The protein concentration was quantified using bicinchoninic acid (BCA) Protein assay (Sigma-Aldrich). Then 60 μg of the total protein of each genotype was separated on 8% SDS-PAGE and transferred to the PVDF membrane (Amersham ...
-
bioRxiv - Molecular Biology 2021Quote: Protein-G (Protein G Sepharose® 4 Fast, cat# GE17-0618-01) or Protein-A (ProteinA-Sepharose® 4, cat#P9424 Millipore) beads were washed twice with 1x PBS and twice with IP100 buffer (25 mM Tris-HCl 7.9 ...
-
Molecular coevolution of nuclear and nucleolar localization signals inside basic domain of HIV-1 TatbioRxiv - Evolutionary Biology 2021Quote: ... The membranes were washed three times with PBS (5 min each time) and were then incubated with secondary peroxidase-conjugated antibody (1:15,000; Sigma-Aldrich, St. Louis, MO, USA). The antibody-bound proteins were detected using Pierce ECL western blotting substrate (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: The bands were visualized using an acid phosphatase-conjugated secondary antibody and nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP, Sigma-Aldrich, St. Louis, USA) substrate system ...
-
bioRxiv - Cancer Biology 2019Quote: ... Membranes were pre-blocked with 5% low-fat dry milk in TBS-T and incubated with a rabbit polyclonal anti-KHSRP antibody (Sigma-Aldrich Cat# HPA034739, RRID:AB_10601582), or a monoclonal anti-c-Myc antibody (D84C12 ...
-
bioRxiv - Microbiology 2019Quote: ... Membranes were blocked with 5% milk in Tris buffered saline (TBS) and probed with antibodies to HCMV IE1 and IE2 (Merck Millipore; MAB-8131; 1/5000), pp52 (Santa Cruz Biotechnology ...
-
bioRxiv - Microbiology 2019Quote: ... Blots were probed with the following antibodies diluted 1:5000 in 1X TBS-T containing 5% nonfat dry milk: rabbit anti-FLAG (Sigma-Aldrich Cat# F7425, RRID:AB_439687), mouse anti-FLAG (Sigma-Aldrich Cat# F1804 ...
-
bioRxiv - Cell Biology 2021Quote: ... Nitrocellulose membranes were blocked for 1 h with 5 % dried milk resuspended in TBS-Tween 1 % and incubated over-night with primary antibodies: anti-alpha-tubulin (Sigma, T6074, 1:1000 dilution) or anti-UKHC (Santa Cruz Biotechnology ...
-
bioRxiv - Microbiology 2020Quote: ... Infected cells were also fixed and stained as above except that a post-fixation step using 100% methanol for 5 min was included and an OmpB antibody (11) and Hoechst (Sigma, B2261, 1:2500 dilution) was used instead of the anti-Rickettsia I7205 antibody ...
-
bioRxiv - Genomics 2021Quote: ... 5% normal donkey serum in PBS for 1 hour and incubated at 4°C overnight with primary antibody (EMD Millipore, cat. Ab3786, 1:300), then at room temperature for 1 hour with Alexa Fluor 594-conjugated secondary antibody (Life Technologies ...
-
bioRxiv - Neuroscience 2022Quote: ... The membranes were blocked for 1 h in Tris buffered saline with Tween 20 (TBST) buffer with 5% bovine serum albumin (BSA) and incubated with primary rabbit anti-β-actin antibody (Millipore Sigma, cat. #SAB5600204) at 1:20000 ...
-
bioRxiv - Cell Biology 2022Quote: ... Nitrocellulose membranes were blocked for 1 h with the blocking buffer containing 5 % dried milk in TBS-Tween 1 % and incubated over-night with primary antibodies: anti-αTubulin (Sigma, T6074, 1:1000 dilution), anti-acetylated Tubulin (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were incubated with primary antibody to stain tubulin (mouse anti-α-tubulin B-5-1-2 mAb, Sigma-Aldrich, T5168, dilution 1:250) for 4 h at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... After overnight incubation the primary antibodies were washed away and PLA secondary probes were added: Anti-Rabbit MINUS (Sigma Aldrich, #DUO92005, dilution 1:5), Anti-Goat PLUS (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... Guts were incubated overnight at 4°C with a primary anti-catalase antibody (C0979, Sigma; 1:250 in 5% w/v BSA in PBS). After three washes with PBS ...
-
bioRxiv - Neuroscience 2022Quote: To inject a dopamine transporter (DAT) inhibitor (GBR12909, D052, Sigma Aldrich, MO, 5 mg/ml in distilled water with 5% dimethyl sulfoxide, 67-68-5, Sigma Aldrich, MO) or vehicle (distilled water with 5% dimethyl sulfoxide) ...
-
bioRxiv - Pathology 2023Quote: ... The solvent (n=5) or an FXIa inhibitor (ONO-1600586, 3 µmol/L n=5) and mepacrine (Sigma-Aldrich; final concentration 5 µM) were added to the blood before perfusion ...
-
bioRxiv - Immunology 2021Quote: ... the membranes were washed in PBS-T for 40 min and the bound proteins were visualized with anti-FLAG-HRP antibodies (1:10000 in PBS-T for 1h, Sigma-Aldrich, Cat. no: A8592). All steps were performed at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... Flat-mounted retinas were incubated overnight at 4°C with antibodies against RNA-binding protein with multiple splicing (RBPMS; EMD Millipore Corp., Burlington, MA) diluted 1:500 in blocking buffer (2% bovine serum albumin ...
-
bioRxiv - Cancer Biology 2020Quote: ... The membrane was incubated with secondary antibody for 1 hour at room temperature and proteins were detected using chemiluminescent HRP substrate (Merck-Millipore, Merck KGaA, Darmstadt, Germany).
-
bioRxiv - Molecular Biology 2021Quote: ... 500μg of lysates in 500 μL of SEC buffer were incubated for 3 hours with primary antibodies directed to either AGO proteins (WAKO anti-AGO2 #011-22033, EMD Millipore anti-panAGO #MABE56) or directed to T6B-fusion protein (Cell Signaling anti-FLAG #8146S ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-amyloid precursor protein (APP; mouse anti-human monoclonal antibody clone 22c11, dilution 1:10, epitope retrieval time 10 min, MAB348; EMD Millipore, Burlington, MA, USA); anti-glial fibrillary acidic protein (GFAP ...
-
bioRxiv - Cell Biology 2022Quote: ... Labelled RNAs in the eluate were then detected by autoradiography and proteins were subjected to WB using an anti-Flag antibody (Sigma-Aldrich F3165; 1:10000).
-
bioRxiv - Molecular Biology 2022Quote: ... and expression levels of AGAL-FLAG tagged proteins were assessed by Western blot with mouse monoclonal anti-FLAG antibody (F1804, SIGMA-Aldrich, Prague, Czech Republic). Clones demonstrating similar GLA_FLAG transcript and AGAL-FLAG protein amounts were selected for further analyses.
-
bioRxiv - Molecular Biology 2023Quote: ... Histidine tagged PDE4 and GST tagged CP proteins were detected chromogenically using anti-mouse secondary antibodies labelled with alkaline phosphatase (1:30000) (cat#A3562, Millipore Sigma, Burlington, MA, USA) and western blue stabilized substrate for alkaline phosphatase (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... The expression of 3 × FLAG-tagged MpRBOHB proteins was confirmed by western blot analysis using an anti-3 × FLAG antibody (Sigma-Aldrich, Cat. No. F1804).
-
Cellular sialoglycans are differentially required for endosomal and cell-surface entry of SARS-CoV-2bioRxiv - Microbiology 2024Quote: ... Cells were then fixed using 10% formalin and processed for immunofluorescence using an antibody against the HCoV-OC43 N protein (Millipore #MAB9013; diluted 1:500) and a secondary Alexa Fluor 555 conjugated anti-mouse IgG antibody (NEB #4413S ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were normalized to either actin or GAPDH housekeeping proteins with monoclonal antibodies (anti-actin; 1∶1000, Sigma or anti-GAPDH; 1:10,000 Abcam).
-
bioRxiv - Neuroscience 2024Quote: ... and a primary rat antibody against myelin basic protein (MBP) (1:50 in blocking solution; Cat. No. MAB386, Sigma-Aldrich, St. Louis, MO, USA). Following five 5-minute washes at 20°C with PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Vinculin (Vin-11-5) (1:5000; Sigma-Aldrich, SAB4200729, Vin-11-5), mouse anti-α-tubulin (B-5-1-2 ...
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μg human insulin mL-1 and 5×10-7 M hydrocortisone hemisuccinate (Sigma). Cells were seeded and expanded for two weeks and subsequently differentiated for another two weeks in the presence of 1.8% DMSO61 (dHepaRG).