Labshake search
Citations for Millipore Sigma :
1651 - 1700 of 10000+ citations for Cyclohexyl 2 3 4 5 trifluorophenyl ethyl ketone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: (-)-1-(2,5-dimethoxy 4-iodophenyl)-2-aminopropane hydrochloride (DOI, Sigma-Aldrich) was and dissolved in sterile water at a concentration of 1mg/mL ...
-
bioRxiv - Immunology 2024Quote: ... and diluted in 4’,6-Diamidino-2-Phenylindole (DAPI, Sigma Aldrich) and analyzed immediately on a BD FACSymphony A5 High-Parameter Cell Analyzer or BD Canto ...
-
bioRxiv - Plant Biology 2024Quote: ... 2-(4-Amidinophenyl)-6-indolecarbamidine dihydrochloride (DAPI dihydrochloride; Merck Sigma-Aldrich), respectively ...
-
bioRxiv - Pathology 2024Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) (D9542, 1 μg/mL, Sigma) was then added to the tubes and incubated for one hour at RT on a rotary shaker in the dark ...
-
bioRxiv - Cancer Biology 2024Quote: ... FCCP (4 µM) and antimycin A (2 µM) (all Sigma-Aldrich). Cells were placed in a non-CO2 incubator at 37 °C for 1 h prior to the assay ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 mM 4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (AEBSF, Sigma-Aldrich), and two tablets of protease inhibitor cocktails (Roche) ...
-
bioRxiv - Immunology 2024Quote: ... 0.25 µg/ml 4′,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich) was added to cell surface-stained bone marrow single-cells prior to cell sorting.
-
bioRxiv - Cell Biology 2024Quote: ... Nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI, Sigma). Mounted coverslips were imaged on Zeiss Axiovert Observer Microscope equipped with a 100× objective and an ApoTome slicer ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 and 4 h by acidification with 0.4% TFA (Sigma Aldrich).
-
bioRxiv - Developmental Biology 2020Quote: ... 3-5 colonies were picked and incubated in 2mL Terrific Broth (T0918, Sigma) containing 100µg/mL Ampicillin for 8 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... TodoNeo1: 5’–CCG CTT TTC TGG ATT CAT CGA C–3’from SIGMA life science) ...
-
bioRxiv - Biochemistry 2022Quote: ... or 100nM of synthetic RNA [45-mer: 5′ GGGUCAACGUGGGCAAAGAUGUCCUAGCAAGCCAGAAUUCGGCAG −3′] generated by Sigma. In reactions where CifA was co-present with CifB ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1µl of each primer (10µm, 5’: FAATGGCAGAGTGGGGTTGGG, 3’: CGGCAAACGGACAGAAGCATT, Sigma-Aldrich, USA).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Membranes were washed 3×5 min with 0.1% Tween® 20 (Sigma-Aldrich) in TBS before a 1 hour incubation with a 1:5,000 dilution of sheep anti-mouse IgG horseradish perodixase secondary antibody (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... The probe used was as follows: 5’[6FAM]AGACTAATTCTCCTCGGCGGGCACG[TAM]3’ (Sigma Aldrich). Analysis was performed using the Rotor-Gene 6000 Series Software 1.7 (Corbett Life Sciences ...
-
bioRxiv - Neuroscience 2022Quote: ... and laminin for 3 hours at 37°C (5 μg/mL, Sigma L2020). To create single cell suspensions for plating aNSCs ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 dpf larvae were exposed to 3 μM CuSO4 (Sigma-Aldrich, Cat# 451677) diluted in EM in cell strainers (Corning ...
-
bioRxiv - Neuroscience 2022Quote: ... incubated in blocking solution (3% skimmed milk or 5% BSA (Sigma-Aldrich, A9647) in TBS + 0.01% Tween20 (Sigma ...
-
bioRxiv - Pathology 2023Quote: ... washed in TBS (3 × 5 min) and blocked in 1% BSA (Sigma Aldrich) in TBST (0.1% Tween-20 in TBS) ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM 8-bromoadenosine 3′,5′ cyclic monophosphate sodium salt (Sigma-Aldrich; “C”), and 0.1 mM 3-isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Genetics 2023Quote: ... beads were washed 3 times 5 minutes with lysis buffer (Sigma-Aldrich, L3412) on a rotator and protease and phosphatase inhibitors ...
-
bioRxiv - Cell Biology 2024Quote: ... and next 3 chamber volumes of 5 mg/ml κ-casein (Sigma, C0406) dissolved in MRB80 ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µL of Pellet Paint NF Co-precipitant (Sigma Millipore Cat. # 70748-3) and 500 µL of Sodium Acetate (pH 5.2 ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µL of Pellet Paint NF Co-precipitant (Sigma Millipore Cat. # 70748-3) and 500 µL of Sodium Acetate (pH 5.2 ...
-
bioRxiv - Cell Biology 2024Quote: ... Treated films were immediately incubated in 5% (3-Aminopropyl)triethoxysilane (APTES, Sigma, 440140) in ethanol (dark ...
-
bioRxiv - Physiology 2024Quote: ... were dissolved in 1 mL of PBS containing 5% 2-mercaptoethanol (2-ME) (M6250, Sigma-Aldrich) and gently agitated at room temperature for 1 hr. ...
-
bioRxiv - Microbiology 2023Quote: ... 4 µl internal standard (2 g/l L-2-aminoadipic acid, Sigma-Aldrich Chemie GmbH, Buchs, Switzerland), and 3.5 µl diethyl ethoxymethylenemalonate (VWR International AG ...
-
bioRxiv - Neuroscience 2024Quote: ... was centrifugally filtered at 9,100g for 4 h at 4 °C through a 5-kDa cut-off filter (Millipore) to remove proteins ...
-
bioRxiv - Cancer Biology 2021Quote: ... tissues were dehydrated in ethanol successive baths finally cleared in Ethyl Cinnamate (Sigma, 112372). Cleared samples were imaged using the UltraMicroscope SPIM (LaVision Biotech) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Animals of genotype oyIs44 V were mutagenized using 70 mM ethyl methanesulfonate (EMS, Sigma) at 20°C for 4 hours ...
-
bioRxiv - Biophysics 2021Quote: ... 8 mg/mL unlabelled tubulin was incubated with 1 mM N-ethyl maleimide (Sigma) on ice for 10 mins ...
-
bioRxiv - Cell Biology 2021Quote: ... larvae were anaesthetized by adding 40 µg/ml ethyl m-aminobenzoate methanesulfonate (tricaine, Sigma) into the medium ...
-
bioRxiv - Physiology 2021Quote: ... using 0.56 mM of BTEE (N-Benzoyl-L-tyrosine ethyl ester, Sigma 13110-F) as a substrate in 100 mM Tris-HCl buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... and visualized by ethidium bromide (Ethyl hexadecyl dimethyl bromide C20H44BrN) (Sigma Ultra, C5335-1000).
-
bioRxiv - Biophysics 2022Quote: ... anaesthetized with 0.02% aminobenzoic acid ethyl ester (tricaine, Sigma-Aldrich St. Louis, MO, USA), and dechorionated using tweezers ...
-
bioRxiv - Cancer Biology 2022Quote: ... tissues were dehydrated in successive ethanol baths finally cleared in Ethyl Cinnamate (Sigma, 112372). Cleared samples were imaged using the UltraMicroscope SPIM (LaVision Biotech) ...
-
bioRxiv - Bioengineering 2022Quote: ... The OSTEMER 324 Flex layer was developed in ethyl L-lactate (77367, Sigma-Aldrich) for 210 s ...
-
bioRxiv - Developmental Biology 2022Quote: ... Animals were then incubated with a final concentration of 0.05M ethyl methosulfate (Sigma Aldrich) in 4ml M9 buffer on a rotating wheel for four hours at room temperature ...
-
bioRxiv - Plant Biology 2022Quote: var2-9 seeds were submerged in 0.4% (v/v) ethyl methanesulphonate (EMS; Sigma-Aldrich) solution for 8 hours with gentle agitation ...
-
bioRxiv - Neuroscience 2023Quote: ... dehydrated samples were incubated in increasing concentrations of ethyl cinnamate (ECi, #112372, Sigma-Aldrich, Germany ...
-
bioRxiv - Cell Biology 2023Quote: ... Cleared and stained embryos were transferred into ethyl cinnamate (Sigma-Aldrich, #103-36-6). Light sheet imaging was performed using a Zeiss Z.1 Light sheet microscope equipped with a 5x/0.16 detection objective ...
-
bioRxiv - Cancer Biology 2023Quote: ... samples were transferred to Eppendorf tubes with 500 μl ethyl cinnamate (ECi, Sigma 112372) and shaken overnight at RT under dark conditions ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and cells were treated with 0.1 mM of ethyl-methanesulfonate (EMS, Sigma-Aldrich, USA) served as a positive control ...
-
bioRxiv - Neuroscience 2024Quote: ... A 10 µl droplet of 15 mM ethyl butyrate (Sigma Aldrich, Irvine, United Kingdom) diluted in paraffin oil (Sigma Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... Liquid-liquid extraction was done which extracted formic acid into ethyl acetate (Sigma-Aldrich). To remove any remaining water ...
-
bioRxiv - Neuroscience 2024Quote: ... rats were anesthetized via intraperitoneal (i.p.) injection of urethane (ethyl carbamate; Sigma-Aldrich, U2500) at a dose of 1.5 g/kg body weight (2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cordycepin was added to the 3’ end of in vitro transcribed mRNA by substituting 50 mM Cordycepin (3’-deoxyadenosine) 5’-triphosphate sodium salt (Sigma-Aldrich) in 10 mM Tris pH7 for ATP in a poly(A)-tailing reaction with a Poly(A ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 x 10 min 100% EtOH) and cleared (3 x 5 min) in xylene (247642, CAS: 1330-20-7, Sigma Aldrich). Finally ...
-
bioRxiv - Genomics 2023Quote: ... then quickly was cut to small pieces (1-3 mm) in petri dish with 3 -5 ml RMPI medium containing 0.05mg/ml TM Liberase (Sigma Aldrich, 5401119001) and 0.02 mg/ml DNAaseI (ThermoFisher ...
-
bioRxiv - Neuroscience 2023Quote: ... a shRNA sequence based on 5’-GCCTAAATGGTCAAGGAGATA-3’ as the sense nucleotide corresponding to the 3’UTR of mouse mDia1 (NM_007858.4; Sigma-Aldrich, Cat# TRCN0000108685) was designed as an oligonucleotide with overhangs (s ...