Labshake search
Citations for Millipore Sigma :
1451 - 1500 of 10000+ citations for Cyclohexyl 2 3 4 5 trifluorophenyl ethyl ketone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... together with DAPI (4’,6-diamidino-2-phenylindole, Sigma-Aldrich) for 1 hour at room temperature in the dark ...
-
bioRxiv - Systems Biology 2024Quote: ... lysates were reduced with 5 mM 5-tris(2-carboxyethyl)phosphine hydrochloride (TCEP) (Sigma-Aldrich) for 2 min at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Pol κ (Polκ3’) (5’ACUCCAGCCUGAAGAGCGA3’ from Sigma-Aldrich), USP7 (5’CCCAAAUUAUUCCGCGGCAAA3’ from Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... washed 3 × 5 min in PBS with 0.1% Tween (both Sigma Aldrich) and probed for 1 h at room temperature in the dark with IRDye® conjugated secondary Abs against goat IgG (800CW ...
-
bioRxiv - Immunology 2021Quote: ... Scrambled non-targeting siRNA (5’-AAUUCUCCGAACGUGUCACGU-3’) was used as control (Sigma). Briefly ...
-
bioRxiv - Molecular Biology 2023Quote: ... siRNA sequences (5’ – 3’) are the following: Universal siRNA control (Sigma, SIC001)
-
bioRxiv - Developmental Biology 2024Quote: ... 0.1 mM 8-Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (Sigma, No.B7880) and 0.1 mM 3-Isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Cell Biology 2024Quote: ... and siTGN46 with 5’-CCACCGAAAGCGUCAAGCAAGAAGA-3’ sequence were obtained from Sigma-Aldrich. Huh7-ACE2 cells were transfected with siRNA oligos (final concentration ...
-
bioRxiv - Genetics 2024Quote: ... then 5 IU of hCG (Millipore Sigma, Cat# 9002-61-3 C1063) 48 hr later ...
-
bioRxiv - Molecular Biology 2024Quote: Sym/Sub RNA with sequence 5 [GCAUGGGCCC 3 [was synthesised (Sigma Aldrich) and 5′ end labelled using γ32P UTP (Perking Elmer ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM 8-bromoadenosine 3′,5′ cyclic monophosphate sodium salt (Sigma-Aldrich), and 0.1 mM 3- isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Developmental Biology 2023Quote: ... including Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (8Br-cAMP, Sigma B7880), N6,2’-O-Dibutyryladenosine 3’,5’-cyclic monophosphate sodium salt (DB-cAMP ...
-
bioRxiv - Cell Biology 2023Quote: ... The coverslips were treated for 5 min with APES (3-Aminopropyltriethoxysilane, Sigma) and thoroughly rinsed ...
-
bioRxiv - Cell Biology 2023Quote: ... blocked with 3% BSA in PBS and 5% Goat Serum (Sigma, #G9023) for 1h before being incubated with primary antibodies in 3% BSA in PBS for 1h ...
-
bioRxiv - Bioengineering 2024Quote: ... eGFP reverse: 5′-AAG TCG TGC TGC TTC ATG TG -3′ (Sigma); GAPDH forward ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and 0.5 mM 8-bromo-adenosine-3’,5’-cyclic monophosphate (Sigma-Aldrich) in Phenol-red free DMEM/F-12 medium (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... soft PDMS was incubated with 5% (3-Aminopropyl)triethoxysilane (Sigma-Aldrich, #281778) diluted in absolute ethanol for 3 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... N6,2-O-Dibutyryladenosine 3’,5’-cyclic monophosphate sodium salt (D0627, Sigma-Aldrich), and ascorbic acid ...
-
bioRxiv - Microbiology 2020Quote: ... Plaque assays and virus production in MDCK cells were performed in the presence of 1 μg/ml tosyl phenylalanyl chloromethyl ketone (TPCK)-treated trypsin (Sigma Aldrich), whereas similar procedures in Vero cells employed 2.5 μg/ml TPCK-treated trypsin ...
-
bioRxiv - Immunology 2022Quote: ... MDCK cells were infected with either PR8 or rSC35M in serum-free DMEM supplemented with tosylsulfonyl phenylalanyl chloromethyl ketone-treated Trypsin (TPCK-trypsin; Sigma-Aldrich) with a concentration of 0.75 μg/mL ...
-
bioRxiv - Systems Biology 2020Quote: ... We changed medium 2 days later (Day -2) with addition of 3 μg/mL Doxycycline (Sigma D9891) to induce the NIL transcription factors ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 day old transgenic animals were anaesthetized on 2% agarose pads containing 2 mM levamisole (Sigma, L9756). DAF-28::GFP expression pattern was examined in at least 30 animals on day 3 of adulthood ...
-
bioRxiv - Cancer Biology 2021Quote: ... Membranes were blocked overnight at 4°C in 5% BSA (Sigma) then probed using pERK and tERK antibodies (Cell signalling ...
-
bioRxiv - Microbiology 2020Quote: ... Human mAbs were concentrated using Amicon Ultra-4 5 kDa (Millipore). Antibody concentration was determined by absorbance measurement at 280 nm using a Nanodrop and purity was determined using SDS-PAGE ...
-
bioRxiv - Systems Biology 2020Quote: 5’-(4-Fluorosulfonylbenzoyl) adenosine hydrochloride (FSBA) was obtained from Sigma-Aldrich. 1×107 DG75 cells were pelleted and lysed in NP40 buffer containing cOmplete ...
-
bioRxiv - Biochemistry 2020Quote: ... SUPELCOSIL LC18 (30 cm x 4 mm, 5 μm, Sigma-Aldrich), or an Eclipse XDB-C18 column (150 mm x 4.6 mm ...
-
bioRxiv - Molecular Biology 2021Quote: ... pombe cells were labeled with 5 mM 4-Thiouracil (Sigma-Aldrich) for 5 min ...
-
bioRxiv - Immunology 2020Quote: ... and 5 ng/ml of mouse recombinant IL-4 (Sigma-Aldrich) for CSR to IgG1 ...
-
bioRxiv - Immunology 2024Quote: ... and 5 ng/ml of mouse recombinant IL-4 (Sigma-Aldrich) (L-I) ...
-
bioRxiv - Genomics 2023Quote: ... pombe cells were labeled with 5 mM 4-thiouracil (Sigma-Aldrich) for 5 min ...
-
bioRxiv - Cell Biology 2024Quote: ... carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (FCCP; 5 µM, SML2959, Sigma-Aldrich), and Rotenone (1 µM ...
-
bioRxiv - Cell Biology 2020Quote: ... free thiols were blocked by addition of 10 mM N-ethyl maleimide (Sigma) and incubated on a rotator at 4°C for 1 hour.
-
bioRxiv - Neuroscience 2021Quote: ... geranyl acetate and ethyl lactate were diluted 1:10 into paraffin oil (Sigma), and serial dilutions were used to achieve lower concentrations ...
-
bioRxiv - Microbiology 2020Quote: ... Octyl β-D-glucopyranoside was extracted using water-saturated ethyl acetate (Sigma, 34858). Prior to submission of samples for mass spectrometry analysis ...
-
bioRxiv - Cell Biology 2023Quote: Mutagenesis & Genetic Screening: Animals are mutagenized using 70 mM ethyl methanesulfonate (EMS, Sigma) at 20 °C for 4 h ...
-
bioRxiv - Neuroscience 2024Quote: ... euthanized with 1.3% MESAB (MS-222; ethyl-m-aminobenzoate methanesulfonate; Sigma-Aldrich, A5040) and fixed (see below ...
-
bioRxiv - Developmental Biology 2024Quote: ... the samples were rinsed three times with Ethyl cinnamate (ECi) (Sigma-Aldrich, 112372) for 5 min each at room temperature.
-
bioRxiv - Biophysics 2023Quote: ... different amounts of freeze dried GelMA macromer were dissolved in DPBS containing 0.5% (w/v) 2-Hydroxy-4’-(2-hydroxyethoxy)-2- methylpropiophenone (Sigma-Aldrich) as photoinitiator ...
-
Naked Mole-Rat Hematopoietic Stem and Progenitors are Highly Quiescent with an Inherent Myeloid BiasbioRxiv - Cell Biology 2021Quote: Mice aged 6 months or naked mole-rats aged 2-4 years were intraperitoneally (i.p.) injected with 1mg (2′S)-2′-Deoxy-2′-fluoro-5-ethynyluridine (F-ara-EdU; Sigma) from a 10mg/ml stock in DMSO diluted with sterile 0.9% sodium chloride solution (Sigma).
-
bioRxiv - Microbiology 2022Quote: ... Samples were centrifuged 1800 rpm for 6 minutes at 4°C and pellets were resuspended n 3 mL RBC lysis for 4 minutes (Sigma). Samples were centrifuged 1800 rpm for 6 minutes at 4°C and the pellets were resuspended in 200 μl of PBS + 2% FBS + 2 mM EDTA ...
-
bioRxiv - Microbiology 2020Quote: ... and the resulting adhered bacteria on the cover slip were stained with 200 μL of the membrane stain N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide (FM4-64) (Sigma) at a final concentration of 20 μg/mL for 5 minutes ...
-
bioRxiv - Genetics 2020Quote: ... and the colour reaction was carried out with NBT/BCIP (4-nitroblue tetrazolium chloride/bromo-4-chloro-3-indolyl phosphate; Sigma). Sections were dehydrated and mounted with Vectamount (Vector Laboratories ...
-
bioRxiv - Neuroscience 2022Quote: ... with PBS pH 7.4 for 10 min at 4400 x g and 4°C using an Amicon Ultra-4 concentrator with 3 kDa cutoff (Merck Millipore). The degree of labelling (DOL = 1.96 ...
-
bioRxiv - Systems Biology 2024Quote: ... and kept at 4°C for a maximum of 4 hours until plasma was separated via centrifugation (2600g for 10 minutes at 4°C) (Sigma 3-16KL, Sigma Laboratory Centrifuges ...
-
bioRxiv - Biophysics 2020Quote: ... passaged every 3-4 days by trypsinization with trypsin-EDTA solution (Sigma-Aldrich) and moved to the corresponding Petri dishes ...
-
bioRxiv - Plant Biology 2021Quote: Starting reagents 3-hydroxybenzaldehyde 4 and hydrazine hydrate were purchased from Sigma-Aldrich and phenylacetic acid 1 was purchased from Merck ...
-
bioRxiv - Cancer Biology 2021Quote: ... noggin and EGF and containing 10 µM nutlin-3 (Sigma #675576-98-4).
-
bioRxiv - Neuroscience 2020Quote: ... The odorants used were 0.1% 3-octanol and 0.1% 4-methylcyclohexanol (Sigma Aldrich), controlled via three-way solenoids (Lee Company) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3×10-4 M monothioglycerol and 300 μg/ml human transferrin (Sigma Aldrich). Cells were plated in petri dishes (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2023Quote: ... and blocked overnight at 4°C in DPBS with 3% BSA (Sigma, A9647) and 0.05% TritonX-100 ...