Labshake search
Citations for Millipore Sigma :
1601 - 1650 of 10000+ citations for Cyclohexyl 2 3 4 5 trifluorophenyl ethyl ketone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... different concentrations of pure 2-IPM and 3-IPM (Sigma-Aldrich, USA) ranging from 0.1 ng/ml to 1000 ng/ml in high-grade water were used (Supplementary Figure S5) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged every 2-3 days by trypsinization (Sigma-Aldrich, T4049) when density reached approximately 3.0×104 cells/cm2 (Mulas et al ...
-
bioRxiv - Immunology 2024Quote: ... tips were silanized with 2% v/v 3-aminopropyltriethoxysilane (APTES, Sigma-Aldrich) in acetone for 10 min at room temperature (~22°C) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1% each of Phosphatase Inhibitor Cocktails 2 and 3 (Millipore-Sigma). 10 µL of lysate was transferred to a clear 96-well plate (Corning ...
-
bioRxiv - Genomics 2024Quote: ... Embryos were washed 2-3 times in warm M2 media (Sigma M7167), and individually mouth pipetted into 5uL of collection buffer (Trition-X-100 0,5% ...
-
bioRxiv - Genetics 2024Quote: ... PCR products were separated on a 2-3% agarose (Millipore Sigma, 11685678001) gel containing 0.5 µg/mL ethidium bromide (ThermoFisher ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1% each of Phosphatase Inhibitor Cocktails 2 and 3 (Millipore-Sigma). 10 µL of lysate was transferred to a clear 96-well plate (Corning ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1% each of Phosphatase Inhibitor Cocktails 2 and 3 (Millipore-Sigma). Collected lysates were sonicated on ice with a probe sonifier (Branson ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1% each of Phosphatase Inhibitor Cocktails 2 and 3 (Millipore-Sigma). Collected lysates were sonicated on ice with a probe sonifier (Branson ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: For multiphoton microscopy kidneys were fixed in 4% paraformaldehyde overnight at 4 °C and embedded in 3% low-melting point agarose (Sigma- Aldrich). Sections (500 µM ...
-
bioRxiv - Immunology 2022Quote: ... 10 µl of hemolymph was mixed with 90 µl of 3, 4-Dihydroxy-L-phenylalanine (L-DOPA, 4 mg/ml)(Sigma Aldrich) dissolved in nuclease free water (Cytiva) ...
-
bioRxiv - Cancer Biology 2023Quote: ... cleared biopsies were blocked for 3–4 h at room temperature (RT) or overnight at 4°C in blocking buffer (PBS (Sigma-Aldrich), 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Plant Biology 2023Quote: ... Supernatants were incubated for 3-4 h at 4 °C with 15-20 μL of ANTI-FLAG® M2 Affinity Gel (Sigma) and washed 3-4 times with Co-IP wash buffer containing 0.1% Triton-100 but without Phosphatase Inhibitor Cocktails and Protease Inhibitor Cocktail ...
-
bioRxiv - Immunology 2024Quote: ... The filtered supernatant was then concentrated using a centrifugal filter unit with a 3 kDA cutoff at 4°C (Amicon Ultra-4 Centrifugal filters, Millipore, USA). Concentrated supernatant was stored in 200 µL aliquots at −80°C until further analysis.
-
bioRxiv - Developmental Biology 2020Quote: ... 3-5 colonies were picked and incubated in 2mL Terrific Broth (T0918, Sigma) containing 100µg/mL Ampicillin for 8 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... TodoNeo1: 5’–CCG CTT TTC TGG ATT CAT CGA C–3’from SIGMA life science) ...
-
bioRxiv - Biochemistry 2022Quote: ... or 100nM of synthetic RNA [45-mer: 5′ GGGUCAACGUGGGCAAAGAUGUCCUAGCAAGCCAGAAUUCGGCAG −3′] generated by Sigma. In reactions where CifA was co-present with CifB ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1µl of each primer (10µm, 5’: FAATGGCAGAGTGGGGTTGGG, 3’: CGGCAAACGGACAGAAGCATT, Sigma-Aldrich, USA).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Membranes were washed 3×5 min with 0.1% Tween® 20 (Sigma-Aldrich) in TBS before a 1 hour incubation with a 1:5,000 dilution of sheep anti-mouse IgG horseradish perodixase secondary antibody (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... The probe used was as follows: 5’[6FAM]AGACTAATTCTCCTCGGCGGGCACG[TAM]3’ (Sigma Aldrich). Analysis was performed using the Rotor-Gene 6000 Series Software 1.7 (Corbett Life Sciences ...
-
bioRxiv - Pathology 2023Quote: ... washed in TBS (3 × 5 min) and blocked in 1% BSA (Sigma Aldrich) in TBST (0.1% Tween-20 in TBS) ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM 8-bromoadenosine 3′,5′ cyclic monophosphate sodium salt (Sigma-Aldrich; “C”), and 0.1 mM 3-isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 dpf larvae were exposed to 3 μM CuSO4 (Sigma-Aldrich, Cat# 451677) diluted in EM in cell strainers (Corning ...
-
bioRxiv - Neuroscience 2022Quote: ... incubated in blocking solution (3% skimmed milk or 5% BSA (Sigma-Aldrich, A9647) in TBS + 0.01% Tween20 (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... and laminin for 3 hours at 37°C (5 μg/mL, Sigma L2020). To create single cell suspensions for plating aNSCs ...
-
bioRxiv - Genetics 2023Quote: ... beads were washed 3 times 5 minutes with lysis buffer (Sigma-Aldrich, L3412) on a rotator and protease and phosphatase inhibitors ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µL of Pellet Paint NF Co-precipitant (Sigma Millipore Cat. # 70748-3) and 500 µL of Sodium Acetate (pH 5.2 ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µL of Pellet Paint NF Co-precipitant (Sigma Millipore Cat. # 70748-3) and 500 µL of Sodium Acetate (pH 5.2 ...
-
bioRxiv - Cell Biology 2024Quote: ... and next 3 chamber volumes of 5 mg/ml κ-casein (Sigma, C0406) dissolved in MRB80 ...
-
bioRxiv - Cell Biology 2024Quote: ... Treated films were immediately incubated in 5% (3-Aminopropyl)triethoxysilane (APTES, Sigma, 440140) in ethanol (dark ...
-
bioRxiv - Cell Biology 2020Quote: ... DAPI (4’,6-Diamidino-2-phenylindole dihydrochloride, 1:200, Sigma-Aldrich) staining was performed to visualize nuclei ...
-
bioRxiv - Microbiology 2020Quote: ... 4-Hydroxy-2-heptylquinoline (HHQ) was purchased from Sigma (cat. SML0747). 4-Hydroxy-2-heptylquinoline N-oxide (HQNO ...
-
bioRxiv - Biophysics 2020Quote: ... DAPI (4′,6-diamidino-2-phenylindole dihydrochloride, Sigma, 1:500 dilution) was applied for 30 min followed by washes in PBS (3 × 10 sec) ...
-
bioRxiv - Cell Biology 2021Quote: ... Nuclei were visualized with 4’,6-diamidino-2-phenylindole (DAPI; Sigma). Anti-rabbit and anti-mouse Alexa Fluor 488-conjugated (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) was purchased from Sigma-Aldrich. For blood recipient analyses ...
-
bioRxiv - Biochemistry 2022Quote: ... and 150 mg/L sodium 4-methyl-2-oxovalerate (Sigma K0629). Cultures were grown for another 30 min at 37 °C to reach OD600=0.8-1 ...
-
bioRxiv - Bioengineering 2022Quote: ... Nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Sigma). Conventional confocal imaging was carried out using confocal microscopes LSM780NLO (Zeiss ...
-
bioRxiv - Systems Biology 2020Quote: ... 750 μl of 2×10−4 M nFMLP (#F3506, Sigma-Aldrich) was added ...
-
bioRxiv - Synthetic Biology 2021Quote: ... After staining with 4′,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich) in PBS for 5 min ...
-
bioRxiv - Bioengineering 2020Quote: ... and 1:1000 4’,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich), for 3h ...
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were counterstained with 4′6-diamidino-2-phenylindole (DAPI; Sigma). Cells without the addition of primary antibodies served as negative controls ...
-
bioRxiv - Bioengineering 2021Quote: ... Slides mounted with 4’,6-diamidino-2-phenylindole (DAPI, Sigma, D9542) were imaged under the fluorescent microscope (OLYPUS ...
-
bioRxiv - Biochemistry 2021Quote: ... FAPs were treated with 2 μM (Z)−4-hydroxytamoxifen (Sigma-Aldrich) for 48 hours to induce inversion of the R206H-containing exon ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1:200, Sigma-Aldrich) in the dark for 30 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... For nuclear staining 4’,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich) was used ...
-
bioRxiv - Immunology 2020Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich, St Louis, MO) was used at 200 ng/mL for nuclei staining.
-
bioRxiv - Cell Biology 2021Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Sigma, #H0887) and 100 U/ml penicillin/100 μg/ml streptomycin (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Sigma, #H0887) and 100 U/ml penicillin/100 μg/ml streptomycin (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... and 4',6-Diamidino-2-phenylindole (DAPI, Sigma, D9542, 1:1000). After incubation with secondary antibodies ...
-
bioRxiv - Neuroscience 2023Quote: ... incubated with 4′,6-diamidino-2-phenylindol (DAPI, Millipore, 1:5000) for 5 min ...