Labshake search
Citations for Millipore Sigma :
1601 - 1650 of 10000+ citations for 6 Chloro 5 fluoro 1H indole 2 3 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich, P5726 and P0044) and protease inhibitor cocktail (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 μM PD0325901 (Selleckchem S1036) and 3 μM CHIR9902 (Sigma SML1046) 61 ...
-
bioRxiv - Cell Biology 2022Quote: ... Sin1 (3-(4-5 Morpholinyl) sydnone imine hydrochloride (Sigma-Aldrich, Cat-M5793). Media products MEM and F12 (ratio 1:1) ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were transfected with 20nM BubR1 siRNA (5′-AGAUCCUGGCUAACUGUUC-3’) (Sigma-Aldrich) or 20nM Knl1 dsiRNA (5’-ATGCATGTATCTCTTAAGGA AGATGAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Pol κ (Polκ3’) (5’ACUCCAGCCUGAAGAGCGA3’ from Sigma-Aldrich), USP7 (5’CCCAAAUUAUUCCGCGGCAAA3’ from Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... washed 3 × 5 min in PBS with 0.1% Tween (both Sigma Aldrich) and probed for 1 h at room temperature in the dark with IRDye® conjugated secondary Abs against goat IgG (800CW ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5′ to 3′ Primer sequences: Custom primers were obtained from Sigma-Aldrich, St ...
-
bioRxiv - Developmental Biology 2019Quote: ... The cells were passaged per 3–5 days using Accutase (Merck-Millipore), mechanically scraped ...
-
bioRxiv - Genomics 2019Quote: ... were washed 3 times with a 5 mg/mL BSA (Sigma A9418) solution ...
-
bioRxiv - Immunology 2019Quote: ... inhibitors on the autophagic flux pathways (3-MA, 5 μM, Sigma-Aldrich; chloroquine ...
-
bioRxiv - Immunology 2021Quote: ... Scrambled non-targeting siRNA (5’-AAUUCUCCGAACGUGUCACGU-3’) was used as control (Sigma). Briefly ...
-
bioRxiv - Molecular Biology 2023Quote: ... siRNA sequences (5’ – 3’) are the following: Universal siRNA control (Sigma, SIC001)
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM 8-bromoadenosine 3′,5′ cyclic monophosphate sodium salt (Sigma-Aldrich), and 0.1 mM 3- isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Developmental Biology 2023Quote: ... including Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (8Br-cAMP, Sigma B7880), N6,2’-O-Dibutyryladenosine 3’,5’-cyclic monophosphate sodium salt (DB-cAMP ...
-
bioRxiv - Cell Biology 2023Quote: ... The coverslips were treated for 5 min with APES (3-Aminopropyltriethoxysilane, Sigma) and thoroughly rinsed ...
-
bioRxiv - Cell Biology 2023Quote: ... blocked with 3% BSA in PBS and 5% Goat Serum (Sigma, #G9023) for 1h before being incubated with primary antibodies in 3% BSA in PBS for 1h ...
-
bioRxiv - Genetics 2024Quote: ... then 5 IU of hCG (Millipore Sigma, Cat# 9002-61-3 C1063) 48 hr later ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.1 mM 8-Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (Sigma, No.B7880) and 0.1 mM 3-Isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Cell Biology 2024Quote: ... and siTGN46 with 5’-CCACCGAAAGCGUCAAGCAAGAAGA-3’ sequence were obtained from Sigma-Aldrich. Huh7-ACE2 cells were transfected with siRNA oligos (final concentration ...
-
bioRxiv - Molecular Biology 2024Quote: Sym/Sub RNA with sequence 5 [GCAUGGGCCC 3 [was synthesised (Sigma Aldrich) and 5′ end labelled using γ32P UTP (Perking Elmer ...
-
bioRxiv - Systems Biology 2020Quote: ... We changed medium 2 days later (Day -2) with addition of 3 μg/mL Doxycycline (Sigma D9891) to induce the NIL transcription factors ...
-
bioRxiv - Microbiology 2020Quote: ... was then loaded immediately onto the target and overlaid with 1.2 μl of a matrix consisting of 9H-Pyrido[3,4-B]indole (Norharmane) (Sigma-Aldrich) dissolved in 90:10 (vol/vol ...
-
bioRxiv - Microbiology 2023Quote: ... indole and 7-cyanoindole solutions were prepared at 10 mg/ml in vehicle (10% DMSO and Millipore-filtered water), aliquoted and stored at −20 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... animals were injected each day with 150 mg/kg of 4-Chloro-DL-phenylalanine (PCPA, Sigma Aldrich), the last day of injection was 24h before the last FST.
-
bioRxiv - Microbiology 2021Quote: ... Immediately prior to plating on agar plates containing 20 mM 4-chloro-phenylalanine (4-CP; Sigma-Aldrich), the cells were washed twice with phosphate buffered saline (PBS ...
-
bioRxiv - Molecular Biology 2019Quote: ... the cells were washed 2× in PBS and then counterstained with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI; 1:10 000; Sigma) for 10 min at room temperature ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... A volume of 40 μL (corresponding to 4.106 cells/cm2) of suspension was plated on 6 cm plates filled with 2 mL of 2% Phytagel (Sigma-Aldrich) as previously described by Dubravcic et al ...
-
bioRxiv - Cell Biology 2021Quote: ... diluted in 1% normal donkey serum in PBS with 2 µg/mL 4’,6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich) for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... The ionic liquid solution was dialyzed into lysis buffer (6 M urea, 2 M thiourea, 2% CHAPS, 1% DTT) using a 3k MWCO cellulose membrane (Amicon Ultra, Millipore).
-
bioRxiv - Microbiology 2020Quote: 2 μg mRNA suspended in 6 μl RNAse-free H2O was digested with 2 units of nuclease P1 (Sigma N8630) for 3 h at 37 ºC ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... A volume of 40 µL of the mix (corresponding to 8.105 cells) was then plated on 6 cm Petri dishes filled with 2 mL of 2% Phytagel (Sigma-Aldrich), following Dubravcic et al (Dubravcic et al. ...
-
Neuroprotective Effects of VEGF-B in a Murine Model of Aggressive Neuronal Loss With Childhood OnsetbioRxiv - Neuroscience 2023Quote: ... in PBS for 2 h at room temperature and counterstained with 4’,6-diamidino-2-phenylindole (DAPI; 1:10,000; Sigma-Aldrich) to identify cell nuclei.
-
bioRxiv - Molecular Biology 2024Quote: ... 140 and 400 bp with 5’ ends labelled with 6-carboxyfluorescein (6-FAM) and tetramethylrhodamine (TAMRA) were amplified using primers (synthesized from Sigma-Aldrich, supplementary table 1) and incubated with gp275 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 0.25mM (day 1) and 0.125 mM (days 2-6) sodium butyrate (Sigma-Aldrich).
-
bioRxiv - Developmental Biology 2021Quote: ... Sections were counterstained with 4’,6’-diamidino-2-phenylindole (DAPI) (1:3000; Sigma-Aldrich) and coverslips were mounted with FluoroGel (Electron Microscopy Services ...
-
bioRxiv - Neuroscience 2021Quote: ... 2% Penicillin-Streptomycin (Life Tech: 15140-122) and 6 units/ml Nystatin (Sigma: N1638)) and cultures were maintained in incubators at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... DNA was stained with 300 nM 4′,6-diamidino-2-phenylindole (DAPI; Sigma D9542). All imaging (for GFP ...
-
bioRxiv - Neuroscience 2020Quote: ... Nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI; 1:10000; Sigma-Aldrich, St ...
-
bioRxiv - Immunology 2020Quote: ... Dead cells were excluded using either 2-(4-Aminophenyl)-6-indolecarbamidine dihydrochloride (Sigma Aldrich) or Propidium Iodide (Sigma Aldrich) ...
-
bioRxiv - Biochemistry 2021Quote: ... Counterstain with 4◻,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich, St. Louis, MO) for 10 min at room temperature was performed for nuclei visualization ...
-
bioRxiv - Neuroscience 2019Quote: ... Sections were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich, Munich, Germany).
-
bioRxiv - Neuroscience 2021Quote: Nuclei were stained with DAPI (4’, 6-diamidino-2-phenylindole dihydrochloride, Sigma-Aldrich, India) at 1μg/ml.
-
bioRxiv - Cell Biology 2021Quote: ... Nuclei were stained with 0.0001% of 4’,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich). Epifluorescence microscopy images were acquired using either a Leica DM6000B or an Olympus X71 fluorescence microscope.
-
bioRxiv - Cell Biology 2022Quote: ... and nuclei stained with 4ʹ,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich Cat. D8417) for 5 minutes ...
-
bioRxiv - Bioengineering 2022Quote: ... PBS washed and then mounted with DAPI (4′,6-diamidino-2-phenylindole, Sigma, USA), which stains the nuclei of immune cells to visualize the nuclei ...
-
bioRxiv - Cell Biology 2022Quote: ... The nuclei of parasites were stained using 4′,6-diamidino-2-phenylindole (DAPI, Sigma) with final concentration (2 μg/ ml) ...
-
bioRxiv - Neuroscience 2021Quote: ... they were incubated with 0.2 µg/µl 4’,6’-diamidino-2-phenylindole (DAPI; Sigma) for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... Bacterial DNA was stained with Fluoroshield containing DAPI (4’,6-diamidino-2-phenylindole; Sigma). Filaments were imaged using a Zeiss Axio Observer Z1 inverted microscope at 100× magnification with an Axiocam 506 mono CCD-camera and the Zen 2.6 pro software ...
-
bioRxiv - Developmental Biology 2022Quote: ... Nuclei were stained with either DAPI (4′,6-diamidino-2-phenylindole, Sigma-Aldrich F6057).
-
bioRxiv - Developmental Biology 2022Quote: ... Sections were then counterstained with 4′,6-diamidino-2-phenylindole (DAPI; D9542, Sigma-Aldrich) and mounted with Fluoro-Gel (17985-10 ...