Labshake search
Citations for Millipore Sigma :
1751 - 1800 of 10000+ citations for 6 Chloro 5 fluoro 1H indole 2 3 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and postfixed with 4% cold PFA for 10 min followed by permeabilization in 0.5% Triton X-100/PBS for 3 h at room temperature (20–25°C) and incubation with 2 µg ml-1 4′,6-diamino-2-phenylindole (DAPI; D9542, Sigma-Aldrich) for 30 min ...
-
bioRxiv - Biophysics 2021Quote: NmeCas9 was expressed in Rosetta 2(DE3) cells (Millipore Sigma, 71400-3) and grown in LB supplemented with 100 µg/mL Carbenicillin and 34µg/mL Chloramphenicol ...
-
bioRxiv - Immunology 2019Quote: ... the MTT (3-[4,5-Dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) (Sigma-Aldrich) powder is re-suspended into PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... containing Phosphatase Inhibitor Cocktails 2 and 3 (Sigma-Aldrich, St. Louis, MO) and MiniComplete Protease Inhibitor Cocktail (Roche Diagnostics) ...
-
bioRxiv - Cancer Biology 2021Quote: ... MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) (Sigma-Aldrich) for the MTT assay was dissolved in PBS in stock concentration 5 mg/mL and stored at 4 °C in the dark ...
-
bioRxiv - Neuroscience 2022Quote: 2’-3’-dideoxycitidine (ddC) was purchased from Sigma Aldrich (St. Louis, MO). AM1710 was synthesized by the lab of Alexandros Makriyannis (Northeastern University ...
-
bioRxiv - Cancer Biology 2022Quote: ... containing phosphatase inhibitor cocktails 2 and 3 and protease inhibitors (Sigma-Aldrich), for 30–45min at 4 °C ...
-
bioRxiv - Plant Biology 2021Quote: ... 400μL (3 mg/mL) of methylbenzothiazolinone-2-hydrazone (MBTH, Sigma M8006−1G), 200μL of sample and 0.5μI of alcohol oxidase (E.C ...
-
bioRxiv - Biophysics 2019Quote: ... The (-)-1-methyl-2-(3-pyridyl)pyrrolidine was purchased from Sigma-Aldrich Brasil Ltda (Sao Paulo ...
-
bioRxiv - Cancer Biology 2019Quote: ... 10 µl (3–4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma) were added to each well and the plate incubated at 37°C for 3 h ...
-
bioRxiv - Cancer Biology 2019Quote: ... 10 µl (3–4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma) were added to each well and the plate incubated at 37°C for 3 h ...
-
bioRxiv - Genetics 2020Quote: ... 137.14 mg of 2-methylpyridine-3-carboxylic acid (Sigma Aldrich, cat. 325228) were resuspended in 500 μl DMSO anhydrous (Sigma Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... 2 and 3 emulsified 1:1 in Freund’s incomplete adjuvant (Sigma-Aldrich) on days 0 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 µl (3–4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma) were added to each well and the plate incubated at 37°C for 3 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 2 mg/ml N-(3-dimethylaminopropyl)-N′- ethylcarbodiimide hydrochloride (Sigma, 03450) in 50 mM HEPES] for 30 min on slow agitation ...
-
bioRxiv - Cell Biology 2022Quote: ... and phosphatase inhibitors (cocktail 2; P5726; and cocktail 3; P0044; Sigma-Aldrich). Lysates were incubated for 5 min at 100 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and phosphatase inhibitor cocktails 2 and 3 (Sigma-Aldrich, P5726 and P0044). Homogenized sample was left incubating for disulfide bond reduction for 60 min at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: Spheroids were treated every 2-3 days with either GSK343 (Sigma-Aldrich), GSK126 (Selleckchem) ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.05 mM (1,4-di [3’-(2’-pyridyldithio)propionamido] butane) (DPDPB, Sigma 16646) in PBS for 5 min at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 and 3 inhibitor (Glutor, 0.05, 0.1, and 0.25 µM, Sigma, SML2765) for 6 to 72 hours ...
-
bioRxiv - Neuroscience 2023Quote: 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium (MTT) (Millipore Sigma) is converted to water-insoluble product formazan by reduction at mitochondrial complex II of the electron transport chain ...
-
bioRxiv - Biochemistry 2024Quote: ... exponentially growing TriEx cells (3 mL suspension, 2×106 cells/mL, Novagen) in serum-free Insect-XPRESS medium (Lonza ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 mM PMSF and phosphatase inhibitors cocktails 2 and 3 (Sigma-Aldrich). Lysates were cleared by centrifugation at 17000 x g for 15 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... Mice were anesthetized by exposure to 2% to 3% isoflurane (Sigma-Aldrich) for 5 to 10 minutes and intranasally infected with 40 μL of a suspension containing 105 spores for the leukopenic model and 106 spores for the corticosteroid model ...
-
bioRxiv - Microbiology 2024Quote: ... and media was replaced every 2-3 days with MEME medium (Sigma), supplemented with 2 mM L-Glutamine (Gibco) ...
-
bioRxiv - Cell Biology 2019Quote: ... all coverslips were incubated with a 5% 3-aminopropyltrimethoxysilane solution (281778, Sigma-Aldrich) in water for 30 minutes ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3-5 colonies were picked and incubated in 2mL Terrific Broth (T0918, Sigma) containing 100µg/mL Ampicillin for 8 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... TodoNeo1: 5’–CCG CTT TTC TGG ATT CAT CGA C–3’from SIGMA life science) ...
-
bioRxiv - Microbiology 2019Quote: ... for 5 min at 14,000 rpm at 4°C (Sigma 3-KIS centrifuge). Samples were snap-frozen in liquid N2 and delipidated by protein precipitation based on the protocol of Wessel and Flügge (61) ...
-
bioRxiv - Biochemistry 2022Quote: ... or 100nM of synthetic RNA [45-mer: 5′ GGGUCAACGUGGGCAAAGAUGUCCUAGCAAGCCAGAAUUCGGCAG −3′] generated by Sigma. In reactions where CifA was co-present with CifB ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1µl of each primer (10µm, 5’: FAATGGCAGAGTGGGGTTGGG, 3’: CGGCAAACGGACAGAAGCATT, Sigma-Aldrich, USA).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Membranes were washed 3×5 min with 0.1% Tween® 20 (Sigma-Aldrich) in TBS before a 1 hour incubation with a 1:5,000 dilution of sheep anti-mouse IgG horseradish perodixase secondary antibody (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... The probe used was as follows: 5’[6FAM]AGACTAATTCTCCTCGGCGGGCACG[TAM]3’ (Sigma Aldrich). Analysis was performed using the Rotor-Gene 6000 Series Software 1.7 (Corbett Life Sciences ...
-
bioRxiv - Neuroscience 2022Quote: ... and laminin for 3 hours at 37°C (5 μg/mL, Sigma L2020). To create single cell suspensions for plating aNSCs ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 dpf larvae were exposed to 3 μM CuSO4 (Sigma-Aldrich, Cat# 451677) diluted in EM in cell strainers (Corning ...
-
bioRxiv - Neuroscience 2022Quote: ... incubated in blocking solution (3% skimmed milk or 5% BSA (Sigma-Aldrich, A9647) in TBS + 0.01% Tween20 (Sigma ...
-
bioRxiv - Pathology 2023Quote: ... washed in TBS (3 × 5 min) and blocked in 1% BSA (Sigma Aldrich) in TBST (0.1% Tween-20 in TBS) ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM 8-bromoadenosine 3′,5′ cyclic monophosphate sodium salt (Sigma-Aldrich; “C”), and 0.1 mM 3-isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Genetics 2023Quote: ... beads were washed 3 times 5 minutes with lysis buffer (Sigma-Aldrich, L3412) on a rotator and protease and phosphatase inhibitors ...
-
bioRxiv - Physiology 2019Quote: ... Bis-2-(5-phenylacetamido-1,3,4-thiadiazol-2-yl)ethyl sulfide (BPTES, Sigma Aldrich Cat. No# SML0601) was used at a concentration of 20μM for 1 hour in low (5 mM ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cordycepin was added to the 3’ end of in vitro transcribed mRNA by substituting 50 mM Cordycepin (3’-deoxyadenosine) 5’-triphosphate sodium salt (Sigma-Aldrich) in 10 mM Tris pH7 for ATP in a poly(A)-tailing reaction with a Poly(A ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 x 10 min 100% EtOH) and cleared (3 x 5 min) in xylene (247642, CAS: 1330-20-7, Sigma Aldrich). Finally ...
-
bioRxiv - Neuroscience 2023Quote: ... a shRNA sequence based on 5’-GCCTAAATGGTCAAGGAGATA-3’ as the sense nucleotide corresponding to the 3’UTR of mouse mDia1 (NM_007858.4; Sigma-Aldrich, Cat# TRCN0000108685) was designed as an oligonucleotide with overhangs (s ...
-
bioRxiv - Genomics 2023Quote: ... then quickly was cut to small pieces (1-3 mm) in petri dish with 3 -5 ml RMPI medium containing 0.05mg/ml TM Liberase (Sigma Aldrich, 5401119001) and 0.02 mg/ml DNAaseI (ThermoFisher ...
-
bioRxiv - Biochemistry 2023Quote: ... DHEA sulfate (5-androsten-3β-ol-17-one-3-sulfate) and testosterone (4-androsten-17β-ol-3-one) were purchased from Sigma Aldrich. 11β-hydroxyandrostenedione (11β-hydroxy-4-androstene-3,17-dione) ...
-
bioRxiv - Cell Biology 2022Quote: ... Arteries were then stimulated with increasing concentrations of serotonin (5-HT, from 10 -8 to 3· 10 -5 M, Sigma), endothelium-dependent vasodilator acetylcholine (ACh ...
-
bioRxiv - Microbiology 2021Quote: ... glucose were pelleted by centrifugation and resuspended in 5 mL YNBNAG11 pH 5.1 containing 5 μM 3-MB-PP1 (EMD MILLIPORE) or DMSO as a vehicle control ...
-
bioRxiv - Biochemistry 2021Quote: An RNA oligonucleotide (5′ -UUUUCAUGCUACGCGUAGUUUUCUACGCG-3′; 4N) with Cyanine 5.5 at the 5′-end was obtained from Millipore Sigma (USA). The RNA scaffold was annealed in 20 mM HEPES ...
-
bioRxiv - Genomics 2023Quote: ... with 3 mL of cell culture media added to each well and treated with 5 µM 5-azacytidine (A2385, Sigma), 10 µM dexamethasone (D1756 ...
-
bioRxiv - Cell Biology 2023Quote: ... except the protein sample was concentrated to 4 mg/ml and mixed with 0.005% 3-([3-Cholamidopropyl]dimethylammonio)-2-shydroxy-1-propanesulfonate (CHAPSO; Sigma Aldrich) immediately before vitrification ...