Labshake search
Citations for Millipore Sigma :
1401 - 1450 of 10000+ citations for 6 Chloro 5 fluoro 1H indole 2 3 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 2-Chloroquinoline-3-carboxylic acid (Sigma-Aldrich, cat. no 688517), 4-Chloro-DL-phenylalanine salt (Sigma-Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... and subsequently washed 3 times with PBS 2% FBS (Sigma). pDCs were enriched from freshly isolated PBMCs using the human Plasmacytoid Dendritic Cell Isolation Kit II (Miltenyi Biotec ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 mM dNTPs and 4mM MgCl2 (EMD Millipore, 71086-3). The template used for the mutagenesis included the coding sequence for each DIP/Dpr in the appropriate vector generated above.
-
bioRxiv - Genetics 2020Quote: ... 3 mg of each compound was dissolved in 6 mL hexane (Sigma-Aldrich #139386-500ML) and 0.5 mL was pipetted into individual 2 mL glass vials fitted with 9mm PTFE lined caps (Agilent Crosslab ...
-
bioRxiv - Biochemistry 2020Quote: ... The complex was then concentrated to 3-6 mg/ml (Amicon 100 kDa cutoff, Millipore) and loaded onto a size-exclusion column equilibrated with 20 mM HEPES ...
-
bioRxiv - Genetics 2022Quote: ... 3 mg of each compound was dissolved in 6 mL hexane (Sigma-Aldrich #139386-500ML) and 0.5 mL was pipetted into individual 2 mL glass vials fitted with 9mm PTFE lined caps (Agilent Crosslab ...
-
bioRxiv - Physiology 2021Quote: ... 6 corneas from 3 individuals were pooled in 100 μl of Tri reagent (T9424, Sigma). RNA was isolated from TRI reagent (T9424 ...
-
bioRxiv - Immunology 2023Quote: ... the peroxidase substrate ABTS (2,2’-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt, Sigma, A1888) was added and the absorbance determined at 405nm ...
-
bioRxiv - Genetics 2023Quote: ISE6 cells (3×106 cells per well) were plated in 6-well plates (Millipore Sigma) and stimulated accordingly ...
-
bioRxiv - Bioengineering 2020Quote: ... Aortas were then washed in 78% methanol for 5 minutes under gentle movement for a total for 3 times before incubating in a 2% ORO solution (Sigma-Aldrich, St Louis, MO) for 60 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... des-Arg9-Leu8]-BK (B1R antagonist) and 3-(5′-Hydroxymethyl-2′-furyl)-1-benzyl indazole were purchased from Sigma-Aldrich (St. Louis, MO, USA). 8-Bromoguanosine 3′ ...
-
bioRxiv - Systems Biology 2020Quote: BALB/cJ mice were subjected to cutaneous Oxazolone (Oxa) challenge by applying 5% 4-Ethoxymethylene-2-phenyl-2-oxazolin-5-one (Sigma-Aldrich) in acetone and olive oil topical to the skin as described [74] ...
-
bioRxiv - Immunology 2022Quote: Mice were sensitized on the shaved back-skin for two consecutive days with 50 μl of 5% Oxa (4-Ethoxymethylen-2-phenyl-2-oxazolin-5-on, Sigma-Aldrich) diluted in methanol and acetone (1:1 ...
-
bioRxiv - Cell Biology 2020Quote: ... The surfaces were then incubated with 5% (3-Aminopropyl)trimethoxysilane (Sigma) in ethanol for 5 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... CHIR99021 (3 μM) and LY411575 (5 μM, Sigma-Aldrich, no. SML0506). Culture media was changed every other day.
-
bioRxiv - Neuroscience 2021Quote: ... as control siRNA for luciferase was used (5’-UAAGGCUAUGAAGAGAUAC-3’; Sigma). Immediately before transfection 2×106 cells were seeded in 6-well plates in 1.4 ml of medium containing 10% fetal serum ...
-
bioRxiv - Bioengineering 2021Quote: ... 5□μL 3-aminopropyltriethoxysilane (APTES) 99% (Sigma-Aldrich cat. no. 440140) was added ...
-
bioRxiv - Bioengineering 2022Quote: ... The PDMS parts were submerged in a 5% 3-aminopropyltriethoxysilane (Sigma) solution to generate surface amine ...
-
bioRxiv - Neuroscience 2021Quote: ... reversely transfected (human siTDP 5’-GCAAAGCCAAGAUGAGCCU-3’, Sigma-Aldrich or siLUC) and harvested 48 h later ...
-
bioRxiv - Microbiology 2022Quote: ... Pectinase activity by the 3’,5’-dinitrosalicylic acid (DNS) (Sigma-Aldrich) method (Miller ...
-
bioRxiv - Neuroscience 2019Quote: ... as control siRNA for Luciferase was used (5′-uaaggcuaugaagagauac-3′; Sigma). Immediately before transfection 2–4 × 105 cells were seeded in 6-well plates in 1.4 ml of medium containing 10% fetal serum ...
-
bioRxiv - Molecular Biology 2022Quote: ... (5’-CACGGGACAGCCTGAGCGGAACGGTGCTAATCGTGCGGT-3’) strand of e5 probe were synthesized (Sigma-Aldrich) and sense strand was end labelled with [γ32P] ATP using T4 polynucleotide kinase according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... 40 nM of siTDP (mouse siTDP 5’-CGAUGAACCCAUUGAAAUA-3’, Sigma-Aldrich) or non-targeting siLUC (5’-UAAGGCUAUGAAGAGAUAC-3’ ...
-
bioRxiv - Genomics 2022Quote: ... PNP-GMP (guanosine 5′-[β,γ-imido]triphosphate, 3 mM, Sigma) was included in the lysis buffer of TIS(Ret ...
-
bioRxiv - Neuroscience 2023Quote: ... CHIR99021 (3 μM) and LY411575 (5 μM, Sigma-Aldrich, no. SML0506)].
-
bioRxiv - Genetics 2023Quote: ... and 1µM adenosine 3’,5’-cyclic monophosphate (cAMP)(Millipore Sigma, #A9501). To aid in cell atachment ...
-
bioRxiv - Immunology 2023Quote: ... We implanted 5×105 EO771 (ATCC) or AT-3 (EMD Millipore) mouse mammary tumor cell lines and 1×105 mouse mammary fibroblasts orthotopically into 4th inguinal mammary fat pads of 6-8-week-old female C57BL/6J female mice (The Jackson Laboratory)(46) ...
-
bioRxiv - Cell Biology 2023Quote: ... cloned 5’-NdeI to 3’-NotI into pET21a(+) (Novagen, Madison, WI) (pET21a-APOL7C::FLAG::1XHis) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3-5 million cells were fixed with ∼1% formaldehyde (Sigma-Aldrich) for 10 min and lysed ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.1 mM 8-Bromoadenosine 3′,5′-cyclic monophosphate sodium salt (Sigma), and 0.1 mM IBMX (Sigma ...
-
bioRxiv - Biophysics 2023Quote: ... The final master mold received a hydrophobic coating through vapor deposition of 1H,1H,2H,2H-perfluorooctyl-trichlorosilane (Sigma-Aldrich 448931, CAS 78560-45-9) in a vacuum desiccator for 1 day ...
-
bioRxiv - Molecular Biology 2021Quote: A CU RNA hairpin (5’-AAAAGAAAAGACGCGUAGUUUUCUACGCG- 3’) labeled with Cyanine 5.5 at the 5’-end (Millipore Sigma) was annealed in 20 mM HEPES ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Polη (5’GCAAUGAGGGCCUUGAACA3’ from sigma-Aldrich) and Rev1 (5’CAGCGCAUCUGUGCCAAAGAA3’ from Sigma-Aldrich). For control ...
-
bioRxiv - Plant Biology 2023Quote: ... SD-WLH plates were supplemented with either 2.5 or 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich).
-
bioRxiv - Genomics 2019Quote: ... 1.5 g/L (days 0-5 and days 11-28) or 2.5 g/L (days 6-10) NaHCO3 (Sigma-Aldrich), and 0.25 mM (days 3-10 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1.5 g/L (days 0-5 and days 11-14) or 2.5 g/L (days 6-10) NaHCO3 (Sigma-Aldrich), and 0.25 mM ascorbic acid (days 3-10) ...
-
bioRxiv - Immunology 2021Quote: ... or 0.5 μM/ml 5-amino-6-D-ribitylaminouracil (5-A-RU) (courtesy of Jeffrey Aubé, UNC) and 50 μM/ml Methylglyoxal (Sigma). Brefeldin A Solution (Biolegend ...
-
bioRxiv - Cancer Biology 2022Quote: ... then treated with 1 uM of 5-Aza-2-deoxycytidine (5 –Aza, SIGMA, A3656) or PBS for 4 days ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM 2-amino-5-phosphonopentanoic acid and 100 U/ml DNase (DN25, Sigma) for 25 min ...
-
bioRxiv - Neuroscience 2023Quote: ... Fluoxetine (F132) and 4-Chloro-DL-phenylalanine (PCPA; C6506) were purchased from Sigma Aldrich (Deisenhofen, Germany). Drugs were dissolved in 0.9% NaCl to the respective concentration ...
-
bioRxiv - Plant Biology 2023Quote: ... while 4-chloro-7-nitrobenzoxadiazole (NBD-Cl, 97%, Sigma-Aldrich, Merck Group, St Louis, MO, USA) was applied at 270LgLha−1 of active ingredient ...
-
bioRxiv - Immunology 2019Quote: ... inhibitors on the autophagic flux pathways (3-MA, 5 μM, Sigma-Aldrich; chloroquine, 5 μM, Sigma-Aldrich; bafilomycin, 5 μM, Sigma-Aldrich), and inhibitors on the mTOR pathway (Rapamycin ...
-
bioRxiv - Immunology 2019Quote: ... inhibitors on the autophagic flux pathways (3-MA, 5 μM, Sigma-Aldrich; chloroquine, 5 μM, Sigma-Aldrich; bafilomycin, 5 μM, Sigma-Aldrich), and inhibitors on the mTOR pathway (Rapamycin ...
-
bioRxiv - Neuroscience 2022Quote: ... 6-cyano-7-nitroquinoxaline-2,3-dione-disodium salt (CNQX, a non-NMDA receptor blocker), and picrotoxin (PIC, a GABAA receptor blocker) were purchased from Sigma-Aldrich, and L-2-amino-5-phosphonopentanoic acid (APV ...
-
bioRxiv - Biochemistry 2020Quote: ... 2-acetazolamide and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were purchased from Millipore-Sigma ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 mM EDTA and 1 % [v/v] protein phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich)) were added at a concentration of 2 mL/g tissue powder ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were counter-stained with DAPI (4’,6-diamidino-2-phenylindole; Sigma-Aldrich) before mounting in Mowiol.
-
bioRxiv - Cell Biology 2020Quote: ... Some sections were additionally labeled with 4′,6-diamidino-2-phenylindole (DAPI, Sigma D9542 ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 μM (±)-6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid (Trolox, Sigma-Aldrich, 238813) and 1 mM sodium azide in PBS to ensure that the biotinylation reaction does not proceed beyond 1 minute ...
-
bioRxiv - Genetics 2019Quote: ... Counterstaining was performed with either DAPI (4’, 6-diamidino-2-phenylindole dihydrochloride, Sigma) at 1μg/ml ...