Labshake search
Citations for Millipore Sigma :
1451 - 1500 of 10000+ citations for 2 3 Dimethyl 3' 4 methylpiperazinomethyl benzophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Phosphatase inhibitor cocktail 2 and phosphatase inhibitor cocktail 3 were purchased from Sigma-Aldrich (St. Louis, USA). Sequencing grade modified Trypsin (Trypsin ...
-
bioRxiv - Cell Biology 2024Quote: ... Monomer solution (1xPBS, 2 M NaCl, 8.625 % (w/w) Sodium acrylate (97 %, 744-81-3, Sigma Aldrich), 2.5 % (w/w ...
-
bioRxiv - Biochemistry 2024Quote: Samples for NMR spectroscopy were prepared by dissolving pectin (2–3 mg) in D2O (99.9% D, Sigma) with 60 nmol DSS-d6 (99% D ...
-
bioRxiv - Biophysics 2024Quote: ... The cantilever and CS were then washed with acetone and silanized with 2% 3-aminopropyltriethoxysilane (Millipore Sigma) in acetone for 30 minutes at room temperature ...
-
bioRxiv - Bioengineering 2024Quote: ... was added to the PEG solution followed by the addition of 1- [bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate] (HATU; 2.43 g, 6.4 mmol, 2 eq.; Sigma-Aldrich). Next ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 mM 4-aminopyridine (4-AP; Sigma) was added to the perfusate ...
-
bioRxiv - Molecular Biology 2021Quote: ... SC-His+3AT is minimal medium of SC-His supplemented with 3-aminotriazole (3-AT, 0.5mM, Sigma-Aldrich).
-
bioRxiv - Cell Biology 2021Quote: ... and mouse VPS35 (5’-GAUUCGAGAAGAUCUCCCA[dT][dT]-3’&5’-GUAAUGUUCUGGAUUAUAA[dT][dT]-3’) were purchased from Sigma-Aldrich. At 24 h after transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3-Amino-1,2,4-triazole (3-AT) (≥95% TLC) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Z-VAD-FMK ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 3 mg RBD protein in 3 mL PBS were mixed with equal-volume Freund’s complete adjuvant (Sigma-Aldrich) for priming ...
-
bioRxiv - Neuroscience 2023Quote: ... The staining was revealed by exposure to 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... SM and trunSM (tissue lysates) and 14-3-3 was performed using Immobilon Western chemiluminescent HRP substrate (Millipore) and an ImageQuant LAS 500 imager (Cytiva Life Sciences) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and HRP-conjugated Anti-Rabbit IgG Secondary Antibody) and R&D Systems/Minneapolis/MN (14-3-3-Sigma polyclonal goat IgG and HRP-conjugated Anti-Goat IgG Secondary Antibody) ...
-
bioRxiv - Plant Biology 2024Quote: ... Bromo-4-Chloro-3-Indolyl a-D-galactopyranoside (X-a-gal) and 10 mM 3-amino-1,2,4-triazole (3AT) (Sigma). The plates were imaged after 60-72 incubation at 28°C ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from testis tissues (3 WT versus 3 Clpp-null)) with TRI reagent (Sigma-Aldrich), and reverse transcription was done with SuperScript IV VILO Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2023Quote: ... SD-WLH plates were supplemented with either 2.5 or 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich).
-
bioRxiv - Bioengineering 2023Quote: 3 dpf larvae were anesthetized in E3 medium containing 0.16 mg/mL Tricaine (ethyl 3-aminobenzoate; Sigma-Aldrich) and caudal fin transection was performed11 30 minutes prior to imaging ...
-
bioRxiv - Immunology 2024Quote: ... and filtered through a 3-kDa molecular filter (Amicon® Ultra Centrifugal Filter, 3 kDa MWCO, Millipore Sigma) at 4°C for 90 minutes to remove proteins ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’ – CACCGCCGCCTCCGCGCTTCCCCGA – 3’ PIEZO1_sgRNAact_TSS143 (guide 3): 5’ – CACCGAGGCCCCAACGCACCAGGGC – 3’ Modified U251 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; D5796, Sigma), supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2024Quote: ... organoid sections were washed twice for 3 minutes each with 3% bovine serum albumin (BSA) (Millipore Sigma # A2153) dissolved in PBS ...
-
bioRxiv - Microbiology 2024Quote: ... recombinase expression was induced with 1 mM 3-methyl-benzoate (Sigma Aldrich T36609; m-toluic acid; “3-MB”), and cultures were allowed to resume growth overnight before being used in the tolerization experiment (as described earlier) ...
-
bioRxiv - Microbiology 2020Quote: ... For this, NHS-CF555 (5 µl, 2 mM) in dimethyl sulfoxide (DMSO; Sigma-Aldrich Co., LLC) was added to AgNP (500 µl) ...
-
bioRxiv - Systems Biology 2021Quote: ... or dimethyl 2-oxoglutarate (DMKG, 1 mmol/L, Sigma Aldrich, St. Louis, MO, USA; CAT#349631).
-
bioRxiv - Plant Biology 2024Quote: ... The samples (2 mg) were dissolved in 1 mL of dimethyl sulfoxide (DMSO Anhydrous, Sigma-Aldrich) with 0.5% w/w LiBr (Anhydrous free-flowing Redi-Dri ...
-
bioRxiv - Cell Biology 2024Quote: ... 2-Hydroxy-4’-(2-hydroxyethoxy)-2 methylpropiophenome (Sigma Aldrich) photoactivator was suspended in S Basal (final concentrations of all components ...
-
bioRxiv - Biophysics 2021Quote: ... and (3-Aminopropyl) triethoxysilane (Sigma-Aldrich, A3648) in a v:v:v ratio of 100:5:3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... were cultured on 3% polyHEMA (Sigma, P3932) coated 96 well plate for 48 h in a 37 °C humidified incubator with 5% carbon dioxide.
-
bioRxiv - Cell Biology 2020Quote: ... 500 μM Indole-3-acetic acid (Sigma) was added 8 h after released ...
-
bioRxiv - Cell Biology 2020Quote: ... 1i-LIF (3 µM CHIR99021, Sigma-Aldrich, cat.no ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:100 Phosphatase Inhibitor cocktail 3 (Sigma), 50mM EDTA ...
-
bioRxiv - Cell Biology 2020Quote: ... – 50 μM in DMSO (3) Tunicamycin (Sigma) – 5 μg/ml in DMSO for 6hr (4 ...
-
bioRxiv - Immunology 2021Quote: ... or 3-MA (5 mM, Sigma-Aldrich), as indicated in the figure legends ...
-
bioRxiv - Genetics 2021Quote: ... Ni-NTA resin (EMD Millipore, 70691-3) was used to remove unreacted His-tagged nanobodies and His-tagged Sortase 5M enzyme ...
-
bioRxiv - Biochemistry 2020Quote: ... or 3) Lipopolysaccharide (LPS) (Sigma-Aldrich L3024) + interferon-γ (IFNγ ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 3 mM deferoxamine from Sigma (# BP987). Next ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3-Indoleacetic acid (Auxin, Sigma-Aldrich, I2886) was dissolved in 100% ethanol and diluted 400 times in the culture medium obtaining concentrations as indicated ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3% Bovine Serum Albumin (BSA; Sigma, A2153), 0.5% Triton™X-100 (Sigma ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3 % normal donkey serum (Sigma-Aldrich D9663), and 0.3 % Triton X-100 (Sigma 93443) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1% Phosphatase Inhibitor Cocktail 3 (Sigma-Aldrich) and 0.5% Phosphatase Inhibitor Cocktail 2 (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... and the following primers (Sigma, 5′-3′): 18S F ...
-
bioRxiv - Molecular Biology 2020Quote: ... with 3 μg anti-FLAG (M2, Sigma), anti-PAN acetylated H3 (Merck) ...
-
bioRxiv - Bioengineering 2022Quote: ... in PBS solution containing 3% BSA (Sigma) for 15 min ...
-
bioRxiv - Immunology 2021Quote: ... and 3% foetal calf serum (FCS; Sigma). To distinguish between live and dead cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were blocked with 3% BSA (Sigma) in PBS before overnight incubation at 4°C with antibodies anti-γH2AX (1:250 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and either 3 mM unlabeled ATP (Sigma) or 25 μCi of [γ32P] ATP ...
-
bioRxiv - Biophysics 2020Quote: ... 100 μg/mL 3×FLAG peptide (Sigma)) ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 µM Na- orthovanadate (Sigma; Cat. # S6508), 1.2 mM DTT (Sigma ...
-
bioRxiv - Synthetic Biology 2020Quote: ... chlorsulfuron (10 µM, Sigma 64902-72-3) or kanamycin (125 µg/mL ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3 mL HEPES (1M stock) (Sigma, H3537), 1.68 mL NaHCO3 (892.75 mM solution ...
-
bioRxiv - Genetics 2021Quote: ... and 3 mM GSK3 inhibitor CHIR99021 (Sigma). Cells were kept in an incubator at 37°C and 5% CO2.