Labshake search
Citations for Millipore Sigma :
1301 - 1350 of 10000+ citations for 2 3 Dimethyl 3' 4 methylpiperazinomethyl benzophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-I (Sigma, 5′-AAGCAACTCGAAGAACATCTC-3′) (107) ...
-
bioRxiv - Microbiology 2024Quote: ... with 3% BSA (Sigma-Aldrich – A1906) in PBS for 20 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... 3 µM CHIR99021 (Sigma-Aldrich SML1046), 1 µM PD0325901 (Sigma-Aldrich PZ0162) ...
-
bioRxiv - Plant Biology 2024Quote: A 3% Phloroglucinol (Sigma Aldrich, UK) - HCl solution (Weisner stain ...
-
bioRxiv - Neuroscience 2024Quote: ... LY294002 (Sigma; Cat# L9908, 3 μM).
-
bioRxiv - Cancer Biology 2024Quote: ... CHIR99021 (Sigma Aldrich, #SML1046, 3 µM), and Rspo3-Fc Fusion Protein Conditioned Medium (Immunoprecise ...
-
bioRxiv - Molecular Biology 2024Quote: ... monothioglycerol (3 μL/mL, Sigma-Aldrich), BMP-4 (bone morphogenic protein 4 ...
-
bioRxiv - Plant Biology 2024Quote: ... and phosphatase inhibitor cocktail 3 (Sigma)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 µM GSK3- inhibitor (CHIR99021, Sigma), 1 µM MEK-inhibitor (PD0325901 ...
-
bioRxiv - Microbiology 2024Quote: ... Rev: 5’ TGTCCGTGAGCCTTCCTGTTTCCCACAGCGTCC 3’ (Sigma-Aldrich). RNA was generated from linearized DNA by in vitro transcription and transfected into BHK21 cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Neuroscience 2024Quote: ... and .3% triton X (Sigma-Aldrich) in MilliQ water for 2 hours ...
-
bioRxiv - Plant Biology 2024Quote: ... PEG8000 (Sigma, Cat#25322-68-3) was added to the indicated final concentrations ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3% horse serum (Sigma-Aldrich) was used for blocking.
-
bioRxiv - Microbiology 2024Quote: ... 3 µg/mL mitomycin C (Sigma) was added to induce the tailocin genes in the P ...
-
bioRxiv - Microbiology 2024Quote: ... dynasore (304448-55-3, EMD millipore), desatinib (BMS-354825 ...
-
bioRxiv - Biophysics 2024Quote: ... x 3/32 in (Sigma-Aldrich) and Elbow Luer connector male (Thistle Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 mM magnesium acetate (Sigma #63052), 0.1 mM EDTA (Invitrogen #AM9261) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 1x Benzonase (Millipore 70664-3). Protein was quantified using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific 23225 ...
-
bioRxiv - Cell Biology 2024Quote: Rosetta (DE3) cells (Millipore, 71397-3) were transformed with pET plasmids encoding 6xHis-3C-HA-TXNL1 (WT ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 3% (w/v) BSA (Sigma) was used to pre-block cells for 30min at RT ...
-
bioRxiv - Cell Biology 2024Quote: ... 3% β-mercaptoethanol (Sigma-Aldrich, M6250), 10 min at 95°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... and CTNNB1: 5’- CUCAGAUGGUGUCUGCUAU-3’ (Sigma). A complete list of antibodies is provided in Supplemental Table 2.
-
bioRxiv - Cell Biology 2024Quote: ... Millipore Sigma)/3% Fish Gelatin (G7765, Sigma Aldrich) and incubated with primary antibodies at 4°C overnight ...
-
bioRxiv - Bioengineering 2024Quote: ... Solvent Green 3 (Sigma-Aldrich, #211982), and Solvent Yellow 7 (#S4016) ...
-
bioRxiv - Cell Biology 2024Quote: ... carbonyl cyanide 3-chlorophenylhydrazone (CCCP, Sigma), 2-deoxy-D-glucose (2DG ...
-
bioRxiv - Developmental Biology 2024Quote: ... Glucose (Sigma-Aldrich, 3 mg/g); Sodium Lactate (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 µM sodium selenite (Sigma-Aldrich), 2.5 mg/mL insulin (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2024Quote: ... human ZBP1: 5’-CGGTAAATCGTCCATGCTT-3’ (Sigma). The gRNAs were cloned into pSpCas9n(BB)-2A-GFP plasmid (PX461 ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 μM 4-(N-Ethyl-N-phenylamino)-1,2 dimethyl-6-(methylamino) pyrimidinium chloride (ZD7288) (Sigma-Aldich), 10 μM 1-[2-[[(Diphenylmethylene)imino]oxy]ethyl]-1,2,5,6-tetrahydro-3-pyridinecarboxylic acid hydrochloride hydrochloride (NO711 ...
-
bioRxiv - Cancer Biology 2022Quote: ... in PBS for 4 h and then exposed to 100 µL dimethyl sulfoxide (DMSO; Sigma-Aldrich). Cell viability was measured by absorption at 570 nm in a microplate spectrophotometer (Spectromax 250 plate reader) ...
-
bioRxiv - Immunology 2023Quote: ... 1 x 15 minutes of recording with DMPP (1,1-Dimethyl-4-phenylpiperazinium iodide, Sigma-Aldrich D5891) application and 1 x 15 minutes of washout recording ...
-
bioRxiv - Physiology 2023Quote: ... Conditioned medium or controls were diluted 1:2 with dimethyl-methylene blue (Sigma Aldrich, 341088) and absorbance at 595nm was measured on a spectrophotometer.
-
bioRxiv - Biophysics 2023Quote: ... 5 % D2O (Eurisotop) and 5 mM DSS-d6 (2,2-dimethyl-2-silapentane-5-sulfonate, Sigma) as internal reference (Wishart and Sykes ...
-
bioRxiv - Cell Biology 2020Quote: ... 40 mL of 3% polyvinyl alcohol (3% w/v PVA) (Sigma-Aldrich CO., St. Louis, MO, USA) were added and the mixture was mechanically stirred at 600 rpm for 4 h (RW-20 ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were then placed in 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Cell Biology 2020Quote: Mice were injected intraperitoneally with 3 mL of 3 % (v/v) thioglycolate (thioglycolic acid, Sigma-Aldrich, T3758) in PBS to elicit peritoneal macrophages using a 25G needle ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Bioengineering 2020Quote: ... we added 200 μL of a freshly made 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma-Aldrich) solution 2% w/v (corresponds to 10 mg EDC in 500 μL MES buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Bioengineering 2020Quote: ... pH 5.8 and reacted with 600 molar excess of 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma) and 200 molar excess racemic aminomethylnicotine for 20h ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coupled with the Supelco Discovery HS F5-3 HPLC column (150 ×2.1 mm × 3 µm) (Sigma Aldrich). Mobile phase A consisted of 10 mM ammonium formate ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were placed into a diaminobenzidine (DAB) solution in dH20 (Sigma-Aldrich Fast 3–3’ Diaminobenzidine Tablets) for 2 minutes and then rinsed thoroughly with TBS to prevent further DAB reactions ...
-
bioRxiv - Molecular Biology 2021Quote: ... concentrated to ∼3 mg/mL using Amicon Ultra centrifugal filter (3 kDa molecular weight cut-off) (Millipore) and loaded onto the size-exclusion Superdex 75 10/300 GL (GE Healthcare ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3 mM N6,2′-O-Dibutyryladenosine 3′,5′-cyclic monophosphate sodium salt (cAMP, #D0260, Sigma-Aldrich, USA). Electro medium consists of 1:1 DMEM/F-12 (#31331028 ...
-
bioRxiv - Systems Biology 2022Quote: ... 3 ml of supernatant were homogenized with 3 ml of ethyl acetate (Millipore Sigma, item number 270989). Organic and aqueous layers were separated by centrifugation at 3 ...
-
bioRxiv - Cell Biology 2024Quote: ... 50 μl of 3 μM TO-PRO-3 or 50 μl 10 μg/mL DAPI (Sigma D9542) in PBS was added ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluates 1-3 were mixed and concentrated with Amicon Ultra-15 (Merck Millipore, MWCO 3 K) to protein concentrations of 44–162 µM.
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...