Labshake search
Citations for Millipore Sigma :
1251 - 1300 of 10000+ citations for 2 3 Dimethyl 3' 4 methylpiperazinomethyl benzophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and 1-bromo-3-chloropropane (Sigma) using phase separation method.
-
bioRxiv - Physiology 2023Quote: ... and 3 mM glycine (Sigma, G7126) for one hour at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3-Octanol (OCT, Sigma-Aldrich), which was diluted 1:10 in paraffin oil (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 3 μM CHIR99021 (Sigma-Aldrich). Stable cell lines were blasticidin (Fisher Scientific ...
-
bioRxiv - Systems Biology 2024Quote: ... DMS (3 μL, Sigma-Aldrich D186309) was added to the folded RNA solution and allowed for 2 min incubation at 37 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... SUMO2/3 (Catalog no. 633306, Sigma and Catalog no ...
-
bioRxiv - Biochemistry 2024Quote: ... PI(3)P-16:0 (Sigma), PMA (Sigma) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 µM CHIR99021 (SML1046; Sigma-Aldrich), 10 µM SB 202190 (S7076 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Palmitic Acid (Sigma, 57-10-3), Rapamycin (LC laboratories ...
-
bioRxiv - Cell Biology 2023Quote: ... and 3-octanol (OCT, Sigma, 218405). Approximately 100 flies were placed in the center compartment of the T-maze ...
-
bioRxiv - Immunology 2023Quote: ... and 3 μM CHIR99021 (Sigma, SML1046), with a final FBS concentration of 10% ...
-
bioRxiv - Neuroscience 2023Quote: ... Biocytin (3 mg/ml, Sigma-Aldrich) was routinely added to the intracellular solution to allow for post-hoc confirmation of cell morphology and localization (Figure 1F).
-
bioRxiv - Molecular Biology 2023Quote: ... T3 hormone 3 µg/mL (Sigma), rhPDGF-AA 40 ng/mL (R&D Systems) ...
-
bioRxiv - Neuroscience 2023Quote: ... β3 tubulin (1:1000, Sigma #T8578), peripherin (1:1000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 mM trolox (Sigma-Aldrich, 238813), 0.8% D-(+)- Glucose (Nacalai Tesque ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3 µg/ml Laminin (Sigma). For immunostaining ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 μM TPP chloride33 (Sigma-Aldrich), 3 mM NiCl232 (Fischer) ...
-
bioRxiv - Biochemistry 2022Quote: N’-[3-pyrenyl]-maleimide (Sigma-Aldrich) was used to react with the gel-filtered G-actin as previously described (Cooper et al ...
-
bioRxiv - Biophysics 2022Quote: ... 3-sn-phosphatidic acid (Sigma Aldrich), Brain phosphatidylserine (Avanti Polar Lipids ...
-
bioRxiv - Cell Biology 2022Quote: ... blocking with 3 % BSA (Sigma-Aldrich) for 1 h at room temperature was performed ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-Desmoglein 3 5G11(Sigma-Aldrich); 1407 Chicken anti-PG (Aves Laboratories) ...
-
bioRxiv - Genetics 2022Quote: ... and 3 μM CHIR99021 (Sigma, #SML1046). mESCs for methylation analysis were cultured in 2i+serum conditions as above ...
-
bioRxiv - Microbiology 2022Quote: ... concentrated (Amicon 3 K Sigma Aldrich) and loaded onto a Superdex 200 increase 10/300 GL column (GE healthcare ...
-
bioRxiv - Microbiology 2022Quote: ... indole-3-pyruvic acid (Sigma, Spain) and indole-3-acetic acid (GoldBio ...
-
bioRxiv - Plant Biology 2022Quote: ... 3 mM spermidine (Sigma-Aldrich, USA), and 50 mM octopamine (Sigma-Aldrich ...
-
bioRxiv - Physiology 2023Quote: ... Oxygen consumption rates were calculated and normalized for protein content by Novagen BSA assay (71285-3, Sigma-Aldrich). Results are shown as fold change with respect to CM baseline condition.
-
bioRxiv - Physiology 2023Quote: ... protein concentration was quantified by Novagen BSA assay (71285-3, Sigma-Aldrich).
-
bioRxiv - Pathology 2023Quote: ... 3 μM TSA (Sigma-Aldrich, T8552), and 0.75 mg/mL trypsin (Gibco™ 15400054) ...
-
bioRxiv - Biochemistry 2023Quote: ... phosphatase inhibitor cocktail 3 (Sigma- Aldrich) and complete protease inhibitor cocktail (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... and 3 mM ATP (Sigma-Aldrich) was added for 1 h to selectively activate NLRP3 ...
-
bioRxiv - Cell Biology 2022Quote: ... Benzonase Nuclease HC (Millipore, 71205-3), Urea (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3% normal donkey serum (Sigma) diluted in 0.1% PBS-T ...
-
bioRxiv - Plant Biology 2023Quote: ... and pGEX-4T-3 vectors (Novagen) for expression in E ...
-
bioRxiv - Developmental Biology 2023Quote: ... Arp2/3 complex (Sigma-Aldrich MABT95), N-WASP (Thermo Fisher Scientific PA5-52198) ...
-
bioRxiv - Microbiology 2023Quote: ... BPS (Sigma CAS# 52746-49-3), cobalt chloride (Sigma CAS# 7791-13-1) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 3 mM Na2-ATP (Sigma-Aldrich), 0.2 mM Na-GTP (Sigma-Aldrich) ...
-
bioRxiv - Genetics 2023Quote: ... Doxycycline (3 ug/ml, Sigma Aldrich) was added to induce TetO gene expression ...
-
bioRxiv - Bioengineering 2023Quote: ... or 3% BSA (Sigma-Aldrich, USA). 100,000 PEO4 cells were seeded on top of each coating and incubated for 2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 3 µM CHIR99021 (Sigma-Aldrich SML1046), 1 µM PD0325901 (Sigma-Aldrich PZ0162) ...
-
bioRxiv - Neuroscience 2024Quote: ... LY294002 (Sigma; Cat# L9908, 3 μM).
-
bioRxiv - Bioengineering 2024Quote: ... deionized water (Direct-Q 3 Millipore, Billerica ...
-
bioRxiv - Biophysics 2024Quote: ... x 3/32 in (Sigma-Aldrich) and Elbow Luer connector male (Thistle Scientific ...
-
bioRxiv - Plant Biology 2024Quote: A 3% Phloroglucinol (Sigma Aldrich, UK) - HCl solution (Weisner stain ...
-
bioRxiv - Molecular Biology 2024Quote: ... monothioglycerol (3 μL/mL, Sigma-Aldrich), BMP-4 (bone morphogenic protein 4 ...
-
bioRxiv - Cancer Biology 2024Quote: ... CHIR99021 (Sigma Aldrich, #SML1046, 3 µM), and Rspo3-Fc Fusion Protein Conditioned Medium (Immunoprecise ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 mM magnesium acetate (Sigma #63052), 0.1 mM EDTA (Invitrogen #AM9261) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 1x Benzonase (Millipore 70664-3). Protein was quantified using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific 23225 ...
-
bioRxiv - Microbiology 2024Quote: ... Rev: 5’ TGTCCGTGAGCCTTCCTGTTTCCCACAGCGTCC 3’ (Sigma-Aldrich). RNA was generated from linearized DNA by in vitro transcription and transfected into BHK21 cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Microbiology 2024Quote: ... 3 µg/mL mitomycin C (Sigma) was added to induce the tailocin genes in the P ...
-
bioRxiv - Microbiology 2024Quote: ... dynasore (304448-55-3, EMD millipore), desatinib (BMS-354825 ...