Labshake search
Citations for Millipore Sigma :
1401 - 1450 of 1517 citations for R + SCH 23390 hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: Cells were treated with several compounds that activated or inhibited EP2 and EP4: EP2 agonist (R)-Butaprost (Sigma), EP4 agonist L-902688 (Cayman Chemicals) ...
-
bioRxiv - Microbiology 2022Quote: ... the presence of Fucα1-2Gal-R was detected with a TMB (3,3’,5,5’-tetramethylbenzidine) kit (Sigma-Aldrich, USA), and the signal intensities [the optical density at 450 nm (OD450)] were read with a Multiskan Sky plate reader (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were placed in eriochrome cyanine solution (0,1% eriochrome cyanine R, 5% ferric ammonium and 0.25% sulfuric acid; Sigma) 30 minutes at r.t and washed with tap water ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and HRP-conjugated Anti-Rabbit IgG Secondary Antibody) and R&D Systems/Minneapolis/MN (14-3-3-Sigma polyclonal goat IgG and HRP-conjugated Anti-Goat IgG Secondary Antibody) ...
-
bioRxiv - Molecular Biology 2023Quote: HeLa Flp-In T-Rex cell line (a kind gift from R. Szczęsny) was cultured in Dulbecco’s Modified Eagle’s Medium (Cat: 6429; Sigma Aldrich) supplemented with 10% fetal bovine serum (Cat ...
-
bioRxiv - Synthetic Biology 2023Quote: 4 μl of purified Chimera (0.5 mg/ml) was applied onto carbon-coated Quantifoil R 1.2/1.3 grids (Sigma-Aldrich) which previously were glow discharged for 120 seconds at 5 mA ...
-
bioRxiv - Immunology 2023Quote: ... Cells were treated with 10 mM (several concentrations were used in Supplemental Figure 7B) R-BHB (54920; Sigma), 10 mM S-BHB (54925 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 20 ng/ml basic fibroblast growth factor (bFGF, R&D) and 50 ng/ml Cholera Toxin (Merck-SIGMA). Cells were counted using a haemocytometer ...
-
bioRxiv - Bioengineering 2022Quote: ... The ligand-exchanged nanoclusters were purified with a Microcon(R) centrifugal filter (Millipore, molecular weight cutoff of 3kDa) and with PD-10 desalting columns ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: The 5-HT2A antagonist (R)-(+)-α-(2,3-Dimethoxyphenyl)-1-[2-(4-fluorophenyl)ethyl]-4-piperinemethanol (M100907; Sigma Aldrich) at a dose of 0.5 mg/kg.
-
bioRxiv - Bioengineering 2024Quote: ... CultureBoost-R media supplemented with a mixture of 10 μg/ml inulin conjugated to FITC (Sigma-Aldrich, F3272) and 100 μg/mL albumin conjugated to Alexa Fluor 555 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... On day 9 medium was supplemented with FGF8b (100 ng/ml, R&D) and heparin (1 μg/ml, Sigma). On day 11 cells were lifted using Accutase (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... The mitochondrial import assay results were analysed by visualizing the proteins with the Coomassie stain (PhastGel Blue R, Sigma). The proteins were then fixed (20% ethanol and 10% acetic acid) ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse myoblast C2C12 cells (gift from Edgar R. Gomis, iMM, Portugal) were grown in DMEM High Glucose (Sigma Aldrich) supplemented with 20% fetal bovine serum (FBS ...
-
bioRxiv - Physiology 2021Quote: ... and adipokine levels were measured via ELISA (adiponectin: Millipore EZ-MADPK, leptin: Millipore EZML-82K, resistin: R&D MRSN00). For HFD experiments ...
-
bioRxiv - Biophysics 2021Quote: The ATPase activity of MutL or MutL(R-E) was measured by an ATPase/GTPase Activity Assay Kit (Sigma). The analysis was carried out with 5 μM protein in a 40 μL reaction mixture comprised of 20 mM Tris-HCl (pH 7.8) ...
-
bioRxiv - Immunology 2021Quote: ... the γ-secretase inhibitor (2S)-N-[(3,5-Difluorophenyl)acetyl]-L-alanyl-2-phenyl]glycine 1,1-dimethylethyl ester (DAPT; R&D) or dimethyl sulfoxide (DMSO; Sigma) was added to media at the concentrations indicated.
-
bioRxiv - Cancer Biology 2022Quote: ... recombinant SHH (C24II) (50 ng/ml, Cat# 1845-SH-025, R and D) and purmorphamine (1.5 μM, Cat# SML0868, Sigma) and cultured for 5 days (d14 of differentiation) ...
-
bioRxiv - Neuroscience 2023Quote: Pre-treatment with the extracellularly applied selective antagonist of the M2 subtype of mACh-R methoctramine (2 μM, Sigma) (52 ...
-
bioRxiv - Cell Biology 2024Quote: ... IE were maintained in complete RPMI 1640 medium with 11 mM glucose and 0.2% sodium bicarbonate (R-0883, Sigma) supplemented with 5% human serum ...
-
bioRxiv - Genetics 2023Quote: ... Cells were spun and resuspended in 500 µl R medium with or without 10 µg/ml cycloheximide (Sigma Aldrich) and allowed to regenerate cilia for the times specified ...
-
bioRxiv - Cell Biology 2022Quote: ... gels were either fixed and stained with Coomassie Brilliant Blue R 250 or electrophoretically transferred onto nitrocellulose membranes (Millipore) by standard methods ...
-
bioRxiv - Plant Biology 2024Quote: ... primary root tips were cut and placed into a 35 mm petri dish containing a 70 um strainer and 4 mL enzyme solution (1.25% [w/v] Cellulase [“ONOZUKA” R-10, Yakult], 0.1%[w/v] Pectolyase [P-3026, Sigma-Aldrich] ...
-
bioRxiv - Cancer Biology 2024Quote: ... 100 pmols of sgRNAs (Alt-R, IDT) were mixed with 0.8 µl of 100 mg/ml polyglutamic acid (Sigma) and 50 pmols of SpCas9 nuclease (IDT ...
-
bioRxiv - Molecular Biology 2024Quote: ... colonies were fixed and stained using Coomassie blue (50% methanol, 7% acetic acid and 0.1% Brilliant Blue R (all Sigma)) ...
-
bioRxiv - Microbiology 2024Quote: ... The total proteins were detected by using the SDS- PAGE analysis stained with Brilliant Blue R (Sigma, Lot. # MKCJ2486). The proteins were visualized using the GelDoc Go Imaging System (Bio-Rad) ...
-
bioRxiv - Biochemistry 2024Quote: ... 2.5 μl of purified protein (0.5 mg/ml) was applied to Quantifoil Cu 300 mesh R 2/2 grids coated with graphene oxide (Sigma) (52) ...
-
bioRxiv - Microbiology 2022Quote: ... LDs were stained using OIL Red R (1:5000 diluted in water) for 30 min (Sigma-Aldrich, St. Louis, USA). Nuclei were stained with DAPI (1μg/mL) ...
-
bioRxiv - Neuroscience 2021Quote: ... the same amount of total protein extracts were loaded on 10% SDS-PAGE and then stained with Coomassie Blue R-250 (Sigma). Protein expression was quantified by densitometric analysis with the ImageJ Software.
-
bioRxiv - Microbiology 2021Quote: ... FQ-R isolates were selected by plating processed samples onto Tryptone Bile X-Glucuronide (TBX) agar (Sigma-Aldrich, Dorset, UK) containing 0.5 mg/L ciprofloxacin ...
-
Interactions with stromal cells promote a more oxidized cancer cell redox state in pancreatic tumorsbioRxiv - Cancer Biology 2020Quote: ... R-spondin was purified from 293T cells engineered to produce it using a Protein A Antibody Purification Kit (Sigma PURE1A). For PDAC cells grown as 3D organoids in co-culture ...
-
bioRxiv - Cancer Biology 2020Quote: ... R-spondin was purified from 293T cells engineered to produce it using a Protein A Antibody Purification Kit (Sigma PURE1A). Organoids were grown in complete media when passaging ...
-
bioRxiv - Neuroscience 2020Quote: ... Gels were incubated with Coomassie stain (60mg/l Coomassie Blue R-250, 10% v/v acetic acid, both Sigma, UK) Following 24h de-staining in 10% v/v acetic acid ...
-
bioRxiv - Physiology 2020Quote: ... sections were blocked in 5% donkey serum for 1h and incubated in goat anti-periostin antibody (1/400, ref AF2955 R&D) diluted in 5% donkey serum in PBS (D9663, Sigma) over-night at 4°C ...
-
bioRxiv - Immunology 2021Quote: PCR was used to amplify EtMIC3 DNA from the pET22b MIC3 plasmid using primers (F: GCTATCGGATCCCAAGCCGTTCCAGAGG, R: CTGCGAGAATTCGCCACTTGGATCTTCCGTT, 0.4 μM final concentration, Sigma Aldrich) that incorporated appropriate restriction enzyme sites (Bam HI and Eco RI ...
-
bioRxiv - Plant Biology 2020Quote: ... the full-length Sl-AACS ORF sequence was amplified using the primer pair SlAACS1-pET28_F/R (table S3) and was cloned into pET28b (EMD Millipore) using the Gibson assembly kit (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... All antifungal agents were prepared using dimethyl sulfoxide (DMSO) (R & M Chemicals) as solvent and RPMI 1640 (Sigma Aldrich, USA) as diluent ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were probed with polyclonal goat anti-human ACE2 (1:500, AF933, R&D Biosystems) or rabbit anti-human beat-Actin (1:2500, 6L12, Sigma) followed by donkey anti-goat IRdye 680CW or goat anti-rabbit IRdye 800CW (Abcam) ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit, AB15580, Abcam, 1:250; TuJ1: mouse, MAB1195, R and D Systems, 1:100; GFAP: mouse, clone GA5, MAB3402, Millipore, 1:500 ...
-
bioRxiv - Microbiology 2021Quote: ... Frozen samples were thawed on ice for 2 min and 1 mL of HPLC grade methanol (Sigma, 34860-4L-R) added to the pellets ...
-
bioRxiv - Microbiology 2021Quote: ... and SsuT3-oE-R (5′-AGTCAG GGATCC CTA CAC CAC CTT CAC TTT GGT ACC) with KOD Hot Start DNA polymerase (Merck Millipore) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... up to 100 μg of carrier-free IgG antibody was subjected to buffer exchange by washing with R-buffer using a 50 kDa Amicon filter (Millipore) that was pre-soaked with R-buffer ...
-
bioRxiv - Genomics 2022Quote: ... MEFs were reprogrammed by being placed in iPSC medium supplemented with 2μg/mL dox (Sigma-Aldrich, Cat#: 33429-100MG-R) and cultured on irradiated MEFs at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... additionally filtered with a 735 nm LP filter eliciting an isomerization rate of ~17 R*/s) in oxygenated Ames’ medium (Sigma) with constant bubbling (95% O2 ...
-
bioRxiv - Genomics 2020Quote: ... The blocking solution was aspirated and replaced with the same solution with primary antibodies (MAP2-Ck, Abcam ab5392, 1:500; Nanog-Gt, R&D AF1997, 1:200; TRA-1-60 IgM-Ms, Millipore MAB4360 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Sections were then blocked with 5% normal donkey serum in 1X PBS for one hour before overnight incubation in primary antibodies (Foxf1, goat, R&D, 1:300; Sox9, mouse, Invitrogen, 1:200; Sox9, rabbit, Millipore, 1:200; Acta2, mouse, Sigma, 1:800 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Sections were then blocked with 5% normal donkey serum in 1X PBS for one hour before overnight incubation in primary antibodies (Foxf1, goat, R&D, 1:300; Sox9, mouse, Invitrogen, 1:200; Sox9, rabbit, Millipore, 1:200 ...
-
bioRxiv - Microbiology 2020Quote: ... primers 1022700 5F and R were used to amplify the 572 bp 5’ homology flank and primer pair 1022700 3F and R was used to amplify the 673 bp 3’ homology flank (KOD Hot Start DNA Polymerase, Merck Millipore) which were cloned on either side of the sfGFP expression cassette in pkiwi003 (Ashdown et al. ...
-
bioRxiv - Microbiology 2021Quote: ... To visualize protein bands for excising and mass spectrometry processing, gels were stained with Coomassie (40% methanol, 20% acetic acid, and 0.1% Brilliant Blue R (B7920, Sigma-Aldrich)) ...
-
bioRxiv - Immunology 2020Quote: ... Immunofluorescence staining using a goat anti-LYVE1 antibody (R&D) followed by incubation with an Alexa647-conjugated secondary antibody together with Hoechst33342 (Sigma) was performed on 7 µm sections without acetone fixation ...