Labshake search
Citations for Millipore Sigma :
1001 - 1050 of 1517 citations for R + SCH 23390 hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Coverslips were mounted temporarily in an oxygen scavenger buffer (200mM phosphate buffer, 40% glucose, 1M cysteamine hydrochloride (M6500 Sigma), 0.5mg/mL Glucose-oxydase ...
-
bioRxiv - Neuroscience 2023Quote: ... which often lead to mortality.18 SE was induced by injecting pilocarpine hydrochloride (250 mg/kg, s.c.; Sigma Aldrich), and after 2 hrs ...
-
bioRxiv - Bioengineering 2023Quote: ... they were incubated with 4 mg/mL of N-(3-Dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (EDC; Sigma-Aldrich, Schnelldorf, Germany) dissolved in 100 mM 2-(N-morpholino ...
-
bioRxiv - Immunology 2023Quote: ... At 5-7 days post infection mice were orally gavaged with 200 µl 2mg/ml loperamide hydrochloride (Sigma Aldrich) to minimize peristaltic movement for imaging ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were mixed with a final concentration of 10 mM Tris (2-carboxyethyl) phosphine hydrochloride (Cat. # C4706, Sigma Aldrich) and incubated at 57°C for 45 min ...
-
bioRxiv - Neuroscience 2024Quote: ... The device was then pulsed with 3 bolus each of 4 different concentrations of dopamine hydrochloride (Sigma, H8502-10G), 0.5 μM ...
-
bioRxiv - Neuroscience 2024Quote: ... Neurons were plated in 12-well plates on 18mM glass coverslips coated with poly-L-lysin-hydrochloride (Sigma- Aldrich), in a plating medium (500mL MEM ...
-
bioRxiv - Neuroscience 2024Quote: ... each mouse received a bilateral injection of 1.25 μl of 6-hydroxydopamine hydrochloride (6-OHDA, Sigma-Aldrich, 4μg/μl) or vehicle (0.9 % NaCl + Ascorbic Acid 0.02% ...
-
bioRxiv - Developmental Biology 2023Quote: Pups were injected once daily intraperitoneally with 6-hydroxydopamine hydrochloride (6-OHDA) 50ug/g of body weight (Sigma H4381) from post-natal day 0 to 5 ...
-
bioRxiv - Physiology 2023Quote: ... All lentiviral transductions were performed at 30 multiplicity of infection in the presence of 6µg/ml of DEAE-dextran hydrochloride (Sigma).
-
bioRxiv - Molecular Biology 2022Quote: Measurement of secretory IgA (SIgA) in mouse faeces samples after treatment with the ONECUT2 inhibitor CSRM617 Hydrochloride (Sigma-Aldrich) or PBS control was done using the SIgA Mouse Uncoated ELISA kit (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... Disulphide bridges were reduced by the addition of 0.8 μM Tris(2-carboxyethyl)phosphine hydrochloride (Sigma, cat. no. C4706). β-arrestin was labeled by incubation with 0.8 μM Alexa Fluor™ 647 C2 Maleimide (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by quenching of 50μL the deuterium exchange reaction mixture in 50μL pre-chilled 50mM sodium acetate quench solution containing 2 M guanidine hydrochloride (Sigma) and 200 mM TCEP ...
-
bioRxiv - Plant Biology 2024Quote: ... The supernatant was transferred to a fresh tube and reduced with 0.5 mM Tris 2-carboxyethyl phosphine hydrochloride (TCEP, Sigma) for 30 minutes at 60°C and alkylated in 3 mM methyl methanethiosulfonate (MMTS ...
-
bioRxiv - Cell Biology 2024Quote: ... and plated in Induction Medium (Essential 8 Medium,10 μM Chroman1, MedChemExpress, and 2 μg/mL Doxycycline hydrochloride, Sigma) at 400,000 cells per well on double-coated [hESC-qualified Matrigel Matrix and Poly-L-Ornithine (Sigma)] 10 cm tissue-culture treated plates ...
-
bioRxiv - Neuroscience 2024Quote: ZD7288 (Cat. no. Z3777), and zatebradine hydrochloride (Cat. no. Z0127, referred to as zatebradine) were purchased from Sigma-Aldrich. Ivabradine hydrochloride (Cat ...
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 1% yeast extract (Biokar, Pantin, France) and 0.05% L-cysteine hydrochloride (Sigma-Aldrich, St. Quentin Fallavier, France) to promote the growth of all HM bacteria ...
-
bioRxiv - Microbiology 2024Quote: ... with TBST (100 mM Tris-hydrochloride, pH 7.4, 2.5 M sodium chloride, and 0.125% Tween-20 [Sigma Aldrich, P1379]), and incubated with primary antibodies overnight on a shaker at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... aSyn N122C variants were stored in phosphate buffer containing 10 mM Tris(2-carboxyethyl)phosphine hydrochloride (TCEP, Sigma #646547). Protein concentrations were determined spectrophotometrically by UV absorbance measurements at 280 nm with ε = 5690 M-1cm-1 for wt and all αSyn mutants ...
-
bioRxiv - Genomics 2024Quote: ... One hundred microliters of the supernatant was mixed with 100µl 200mM 3-Nitrophenylhydrazine hydrochloride (3NPH in 50% ACN) and 100µl 120mM N-(3-dimethylaminopropyl)- N’-ethylcarbodiimide hydrochloride (EDC in 50% ACN with 6% pyridine) (both Sigma) in a low-binding Eppendorf tube ...
-
bioRxiv - Bioengineering 2024Quote: ... the matrices were incubated with 4 mg/mL N-(3- dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (EDC; Sigma‒Aldrich, Schnelldorf, Germany) dissolved in 0.1 M 2-(N-morpholino)ethanesulfonic acid (MES ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The supernatant was transferred to a fresh tube and reduced with 0.5mM Tris 2-carboxyethyl phosphine hydrochloride (TCEP, Sigma) for 30 min at 60°C and alkylated in 4 mM methyl methanethiosulfonate (MMTS ...
-
bioRxiv - Bioengineering 2024Quote: ... a secondary crosslinking process was performed via exposure to 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDAC, Sigma-Aldrich) and N-hydroxysulfosuccinimide (NHS ...
-
bioRxiv - Cell Biology 2022Quote: GEMC1 and MCIDAS were amplified from FLAG-hBirA*-GEMC1/MCIDAS using forward primers and reverse primers containing SpeI-XhoI restriction sites (GEMC1 F– AAAAACTAGTatggactacaaagacgatgac, R- TTTTCTCGAGCTAAGACTGCTTAGGGACCCA), (MCIDAS, F– AAAAACTAGTatggactacaaagacgatg, R- TTTTCTCGAGTCAACTGGGGACCCAGCGGAAC) using KOD Hot Start DNA Polymerase (Millipore) and cycling conditions recommended from the manufacturer (polymerase activation at 95 °C for 2 min ...
-
bioRxiv - Immunology 2022Quote: ... anti-HA (M- and R-Sigma, 1:1000), and anti-Myc (M-Santa Cruz or R-Cell Signaling Technology ...
-
bioRxiv - Molecular Biology 2021Quote: ... (R)-(-)-3-hydroxybutyric acid sodium salt (Sigma 298360) was added to the culture media at the indicated concentrations ...
-
bioRxiv - Cell Biology 2021Quote: ... Ruthenium Red (1 M, Sigma Aldrich, R-2751) was added to the medium to μ prevent the tonic TRPV4-mediated currents mediating oocyte lysis ...
-
bioRxiv - Plant Biology 2022Quote: ... or Anti-FLAG(R) M2-Antibody (F1804; Sigma) as described in Saleh et al ...
-
bioRxiv - Cell Biology 2022Quote: ... 1mM sodium arsenite (Sigma-Aldrich, 35000-1L-R), dimethyl sulfoxide (DMSO ...
-
bioRxiv - Neuroscience 2021Quote: ... (-)-N6-(2-Phenylisopropyl) adenosine (R-PIA; Sigma Aldrich) dissolved in saline ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant SLAMF7 protein (r-SLAMF7) was from Sigma. Purified anti-SLAMF7 (162.1 ...
-
bioRxiv - Cell Biology 2023Quote: ... L-buthionine (S,R)-sulfoximine (BSO) (Sigma B2515). 3AT ...
-
bioRxiv - Neuroscience 2023Quote: (R,S)-ketamine (10 mg/kg, Sigma-Aldrich) and Clozapine N-oxide dihydrochloride (CNO ...
-
bioRxiv - Plant Biology 2024Quote: ... mounted in Chlorohydrate (Sigma number: 15307-500G-R) solution and analyzed using a Zeiss Axio Imager light microscope.
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... 20 μM R(+) propranolol (Sigma-Aldrich, Cat P0689), DMSO ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.2% Coomassie Brilliant blue R-250 (Sigma, B7920)) for 30 mins ...
-
bioRxiv - Cancer Biology 2023Quote: ... stained with Brilliant Blue R (Sigma-Aldrich; B0149) and subsequently analyzed with the Gel-counter by Oxford Optronix and appertaining Software (version 1.1.2.0) ...
-
bioRxiv - Neuroscience 2024Quote: ... 50 uM CNQX (AMPA-R antagonist; Sigma, C239), or 1 uM TTX (sodium channel blocker ...
-
bioRxiv - Molecular Biology 2024Quote: Racemic propranolol and R(+) propranolol (Sigma-Aldrich, USA) were reconstituted at 10mM in phosphate-buffered saline (PBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... 250 ng/mL R-spondin 3 (Sigma, #SRP3323), 5 nM heregulin (StemCell ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and the resulting dried extracts were derivatized using methyoxyamine hydrochloride (MOX) and N,O-Bis(trimethylsilyl)trifluoroacetamide (TMS) [both purchased from Sigma] ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... In the first experiment, rats were injected with either sterile saline (vehicle; 1 mL/kg, i.p.) or propranolol hydrochloride (PROP, Sigma-Aldrich, St Louis ...
-
bioRxiv - Neuroscience 2021Quote: ... with a single dose of buprenorphine hydrochloride (0.1 mg/kg; Henry Schein) and a single dose of cefazolin antibiotic (25 mg/kg; Sigma-Aldrich) dissolved in sterile saline ...
-
bioRxiv - Molecular Biology 2021Quote: ... Normal medium was then aspirated and replaced with selective medium containing 10-ug/mL of Blasticidine S hydrochloride (Sigma-Aldrich). Selective medium was changed every three days ...
-
bioRxiv - Cancer Biology 2020Quote: ... PANC02 cells were adapted to toxic concentrations of AKT inhibitor X (10-DEBC hydrochloride, SIGMA, CAS number 925681-41-0), by continuous growth with AKTi through a step-by-step increase in concentration until reaching toxic concentrations (50 µM ...
-
bioRxiv - Microbiology 2020Quote: ... pellets were resuspended in 50 μL of lysis buffer (20 mM Tris-HCl pH 7.5, 1 mM EDTA, 0.5 mM Na3VO4, 1 mM benzamidine hydrochloride (Sigma-Aldrich, Germany), 5x cOmplete™ EDTA-free protease inhibitor cocktail (Roche ...
-
bioRxiv - Biophysics 2020Quote: ... were added to 1 mL of 10 mg∙mL−1 of N-(3-dimethylaminopropyl)-N’-ethylcabodiimidie hydrochloride (EDC, Sigma-Aldrich) dissolved in 100 mM sodium phosphate ...
-
bioRxiv - Genetics 2021Quote: ... and 0.1% (w/v) SDS) containing 1× homemade protease inhibitor cocktail (1 mM 4-(2-Aminoethyl)benzenesulfonyl fluoride hydrochloride (Sigma; A8456), 0.3 μM Aprotinin ...
-
bioRxiv - Neuroscience 2021Quote: ... was administered 30 min before pilocarpine hydrochloride (25 mg/kg at P21 and 350 mg/kg at P42, in saline, i.p.; Sigma-Aldrich). For P21 rat pups ...
-
bioRxiv - Bioengineering 2021Quote: ... in 100 mM sodium phosphate - 5 mM ethylenediaminetetraacetic acid (EDTA) buffer (pH 6.5) with 10 mM L-cysteine–hydrochloride (all from Sigma-Aldrich) at 60 °C and 10 rpm for 18 hours ...