Labshake search
Citations for Millipore Sigma :
1351 - 1400 of 1517 citations for R + SCH 23390 hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Inositol depletion regulates phospholipid metabolism and activates stress signaling in HEK293T cellsbioRxiv - Cell Biology 2022Quote: ... Total protein staining of membrane was done using an R-PROB staining kit from Sigma. Primary antibodies were incubated overnight at 4°C and secondaries for 1 hr at RT ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins of the gel were then stained with Coomassie blue R-250 (Sigma-Aldrich, USA) and the molecular mass of the proteins was determined with reference to standard proteins (Thermo Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... Each well was then washed with PBS and stained with Brilliant Blue R Concentrate (Sigma) for 1 hour with gentle shaking ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli HMS174 (DE3) (F- recA1 hsdR(rK12- mK12+) Rif R (DE3)) was purchased from Novagen. E ...
-
bioRxiv - Neuroscience 2020Quote: ... while the other hemibrain was fixed in 4% paraformaldehyde (PFA) (Sigma-Aldrich, 16005-1KG-R) for 48h ...
-
bioRxiv - Physiology 2021Quote: ... rapamycin (LC laboratories R-5000, lot #ASW-135, and acarbose (Sigma-Aldrich A8980, lot #MKBS1059V0). Compounds were obtained as solids and dissolved in either water or DMSO (dimethyl sulfoxide ...
-
bioRxiv - Cell Biology 2021Quote: ... cytoplasmic dynein (dynarrestin, 50 μM; Sigma-Aldrich and ciliobrevin A, 10 μM; R&D Systems); and β−tubulin (nocodazole ...
-
bioRxiv - Developmental Biology 2020Quote: ... 10ng/mL NT3 (R&D, 267N3025) and 40ng/mL T3 (Thyroid hormone, Sigma, T-6397). Cells were analyzed after 3 days unless otherwise noted.
-
bioRxiv - Genomics 2021Quote: ... Cells were then incubated in primary antibodies (SOX17-R&D Systems, AF1924, SOX2-Millipore, ab5603) diluted at 1:500 in 2% horse serum ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 0.1% 2-mercaptoethanol) containing 10 µM SB431542 (R&D) and 3 µM CHIR99021 (Sigma), and was subsequently replaced every day ...
-
bioRxiv - Developmental Biology 2020Quote: ... incubated with 1: 400 diluted R-Phycoerythrin-conjugated goat anti-rabbit secondary antibody (Sigma, P9537) for 1.5 hrs at 37°C in dark ...
-
bioRxiv - Neuroscience 2023Quote: ... each port entry initiated a trial in which the target odor Limonene R (62118 SIGMA) was delivered for 2 seconds and mice had to lick the water spout to retrieve a water reward ...
-
bioRxiv - Developmental Biology 2022Quote: ... cortisol from the frozen samples was extracted with ethyl acetate (33211-1L-R; Sigma-Aldrich). Cortisol concentration was measured using a commercial ELISA kit ...
-
bioRxiv - Physiology 2023Quote: ... and VEGF concentrations were measured by ELISA (R&D Systems, Mercodia, Abcam, and Sigma, respectively), and total plasma bile acids using a colorimetric assay (Abcam) ...
-
bioRxiv - Physiology 2024Quote: ... The remaining midshafts were incubated at 37[r]C with 0.2% type 1 collagenase (Sigma) for 30 minutes ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... we tested the hypothesis that (R)-(+)-8-OH-DPAT (Sigma-Aldrich, product Nr: H140-5MG), a 5-HT1A receptor agonist known to inhibit female sexual behavior (Snoeren et al ...
-
bioRxiv - Plant Biology 2022Quote: ... Cell pellets were resuspended in 1 mL of HPLC grade methanol (100%, Sigma, 34860-4L-R), vortexed for 1 min ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 mM HEPES (pH 7.4)) with inclusion of ruthenium red (100 μm; Sigma Aldrich, R-2751) to suppress TRPV4 activity and ensuing cell death [76] ...
-
bioRxiv - Genomics 2020Quote: ... R-loop-IP was performed using Dynabeads-mouse M280 pre-coated with S9.6 antibody (Millipore MABE1095). DNA was then eluted and purified for library preparation with NEBNext Ultra kits (NEB).
-
bioRxiv - Plant Biology 2021Quote: ... equal loading was demonstrated by staining the PVDF membrane with Coomassie Brilliant Blue R 250 (Sigma) post immunodetection ...
-
bioRxiv - Immunology 2020Quote: ... and stained with 50 μL of a secondary labeling mix containing ExtrAvidin-R-PE (Sigma-Aldrich), anti-human LC-FITC (Southern Biotech) ...
-
bioRxiv - Genetics 2021Quote: ... SmLE-PZQ-R adult males were individually placed in 96-well plates with filter insert (Millipore) in DMEM complete media ...
-
bioRxiv - Microbiology 2020Quote: ... 15 g/L agar and 0.5 µg/ml anhydrous tetracycline (AHT) (Sigma-Aldrich 37919-100MG-R) were used.
-
bioRxiv - Plant Biology 2023Quote: ... Homogenized samples were serial-diluted and spotted onto R-2A plates (Sigma-Aldrich Cat. No. 17209) supplemented with cycloheximide (15 mg/L ...
-
bioRxiv - Bioengineering 2022Quote: ... for 15 minutes at 37°C before incubating with Rh123 (10µM) (Sigma, catalog No. R-8004) for another 15 minutes.
-
bioRxiv - Molecular Biology 2022Quote: R loops were stained with an S9.6 antibody that recognizes DNA-RNA hybrid (MABE1095, Sigma-Aldrich) by using the same staining and confocal images procedure as RAD-51 antibody staining ...
-
bioRxiv - Biophysics 2022Quote: 4 μL purified Casπ R-loop complex (∼1.5 μM) was cross-linked by BS3 (Sigma-Aldrich) and applied to the graphene oxide grid (Quantifoil Au 1.2/1.3 ...
-
bioRxiv - Bioengineering 2024Quote: ... methanol (Cat. No. 34860-2L-R) and calcein (Cat. No. C0875) were purchased from Sigma-Aldrich. Ethanol (Cat ...
-
bioRxiv - Neuroscience 2024Quote: ... slices were pretreated with a drop of MetOH 100% (34860-1L-R; Merck Sigma-Aldrich, MA) for 10 minutes at -20°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 10ng/mL GDNF (R&D, 212-GD\CF) and 200μM L-ascorbic acid (Sigma-Aldrich, A8960). 12-well plates or 24-well glass-bottomed dishes (Cellvis ...
-
Endothelial transmigration hotspots limit vascular leakage through heterogeneous expression of ICAM1bioRxiv - Immunology 2022Quote: ... 0.5 ng/mL IFN-γ (R&D, 285-IF-100) or 10 ng/mL LPS (Sigma, L2880) 20 hours before an experiment.
-
bioRxiv - Genetics 2020Quote: ... Resin-bound proteins were eluted in R buffer containing 300 mM NaCl and 40 mM glutathione (Sigma). The sample was supplemented with 0.2 µg/mL of HRV-3C protease (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: The following antibodies were used in this study: rabbit anti-R-actin (ABT264 EMD Millipore, 1:2000), mouse anti-GFP (Ab1218 Abcam ...
-
bioRxiv - Bioengineering 2022Quote: Human ovarian cancer A2780 and Adriamycin resistant human ovarian cancer A2780-R cells were procured from Sigma Inc ...
-
bioRxiv - Plant Biology 2022Quote: ... ~0.5cm root tips were harvested from 1000-3000 roots and placed into a 35mm petri dish containing a 70 μm cell strainer and 4.5mL enzyme solution (1.5% [w/v] cellulase [ONOZUKA R-10, GoldBio], 0.1% Pectolyase [Sigma P3026] ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 µM (S)- or (R)-9 and 40 µg of beta-lactoglobulin (BLG, L-3908, Sigma-Aldrich). The reactions were then diluted to 75 µL by sequential addition of MoD buffer ...
-
bioRxiv - Immunology 2021Quote: ... Medium was replaced every 3 days thereafter with fresh R+ containing FCS (10% v/v; Sigma-Aldrich). Antigen-specific CD8+ T cells were characterized via flow cytometry on day 10.
-
bioRxiv - Immunology 2020Quote: ... The gels were subsequently stained with 0.25% Coomassie brilliant blue R (Sigma-Aldrich, St. Louis, MO, USA). Molecular weight and protein fraction levels were determined using readings from a computerized densitometer in R software ...
-
bioRxiv - Genomics 2022Quote: ... we first computed the frequency of each trinucleotide context in the human genome using the function get_trinuc_norm from the R package SigMA (https://github.com/parklab/SigMA). Next ...
-
bioRxiv - Plant Biology 2024Quote: ... Excised roots were placed into a 35mm petri dish containing a 70μm cell strainer and 4.5mL enzyme solution (1.5% [w/v] cellulase [ONOZUKA R-10, GoldBio], 0.1% Pectolyase [Sigma P3026] ...
-
bioRxiv - Cell Biology 2024Quote: ... the culture was supplemented with 100 ml EXCELL R 293 Serum-Free Medium (Sigma-Aldrich, 14571C-1000ML). Another 24 h later ...
-
bioRxiv - Cell Biology 2024Quote: ... the culture was supplemented with 100 ml EXCELL R 293 Serum-Free Medium (Sigma-Aldrich, 14571C-1000ML). Another 24 h later ...
-
bioRxiv - Cell Biology 2024Quote: ... the culture was supplemented with 100 ml EXCELL R 293 Serum-Free Medium (Sigma-Aldrich, 14571C-1000ML). Another 24 h later ...
-
bioRxiv - Cell Biology 2024Quote: ... Total protein content was quantified by staining the polyacrylamide gel with 0.25% Brilliant blue R 250 (Sigma) solution (50% MeOH (v/v) ...
-
bioRxiv - Cell Biology 2024Quote: ... The samples were incubated with CEP120 (generated in Moe R Mahjoub Lab) and Acetylated tubulin (T6793, Sigma) primary antibodies overnight in PBS-T ...
-
bioRxiv - Microbiology 2020Quote: ... The digested proteins were visualized in a 10% acrylamide gel stained with Coomassie Brilliant Blue R (Sigma Aldrich)
-
bioRxiv - Microbiology 2021Quote: ... The coding region was amplified from strain 86-028NP using primers Lav_bind-F (AGTCAGCATATGCAAGATAACTCACACGTTATCG) and Lav_bind-R (CTGACTGGATCCTTAGTGGCGGAAGCGTTGATATTG) with KOD HotStart proofreading DNA polymerase (Novagen) and cloned into the NdeI and BamHI sites of pET15b ...
-
bioRxiv - Microbiology 2022Quote: ... LAM was resuspended at 1 mg/mL in sterile nanopure water (Direct-Q 3 UV-R, Millipore Sigma). 60-μL aliquots were stored in low-retention tubes at –80 °C and thawed immediately prior to use ...
-
bioRxiv - Genomics 2022Quote: ... Doxycycline inducible reprogrammable MEFs were grown in media containing 2μg/mL dox (Sigma Aldrich Cat#: 33429-100MG-R) and 0-200μM 3TC for 15 days ...
-
bioRxiv - Genomics 2021Quote: ... Primary antibodies against the following proteins were used: SOX9 (1:50, AF3045, R&D Systems, and AB5535, Millipore), ERG (1:50 ...