Labshake search
Citations for Millipore Sigma :
1401 - 1450 of 10000+ citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... for 1 hour and incubated with the following primary antibodies diluted in 5% milk with TBST overnight at 4°C: Anti-β-actin (1:5000, A5441-.2ML Sigma); Anti-VAPA (1:1000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The sections were stained with primary antibodies diluted in 5% v/v horse serum over night at 4°C: mouse anti- glucagon antibody (1:1000, Sigma-Aldrich), guinea pig anti-insulin (1:500 ...
-
bioRxiv - Biochemistry 2024Quote: ... Actin was then cleaved off the beads overnight at 4 °C using 5 μg/ml TLCK treated chymotrypsin (SIGMA: C3142-25MG) which was then inactivated by 1mM PMSF ...
-
bioRxiv - Immunology 2024Quote: ... at 37°C in pre-warmed epithelial cell removal solution (HBSS supplemented with 4% iHS [Sigma] and 5 mM EDTA [Sigma]). The remaining tissues containing lamina propria and muscularis layer were digested for 20 min digestion ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were blocked with 5% skimmed milk in TBST buffer for 1 h and incubated ON at 4°C in 5% skimmed milk/TBST with the following primary antibodies: anti-mouse Map2a+b (Sigma #M1406) 1:500 ...
-
bioRxiv - Genomics 2024Quote: ... 10003D) were blocked overnight at 4°C with 75 mg/ml bovine serum albumin (final concentration: 5 mg/ml, Sigma, A7906). The next day ...
-
bioRxiv - Cell Biology 2024Quote: ... The crude lysate was centrifuged at 20,000 RPM for 20 minutes at 4°C and the supernatant was applied to a pre-equilibrated 5 mL nickel column (cOmplete nickel beads, Sigma-Aldrich) at 20 mL/hour using a peristaltic pump at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... fibroblasts were fixed in 4% formaldehyde in PBS for 5 min at 37°C followed by cold 2% formaldehyde in 6.25% methanol (Sigma-Aldrich, #32213) in PBS for 1 min at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Pol κ (Polκ3’) (5’ACUCCAGCCUGAAGAGCGA3’ from Sigma-Aldrich), USP7 (5’CCCAAAUUAUUCCGCGGCAAA3’ from Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... washed 3 × 5 min in PBS with 0.1% Tween (both Sigma Aldrich) and probed for 1 h at room temperature in the dark with IRDye® conjugated secondary Abs against goat IgG (800CW ...
-
bioRxiv - Immunology 2021Quote: ... Scrambled non-targeting siRNA (5’-AAUUCUCCGAACGUGUCACGU-3’) was used as control (Sigma). Briefly ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.1 mM 8-Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (Sigma, No.B7880) and 0.1 mM 3-Isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Molecular Biology 2024Quote: Sym/Sub RNA with sequence 5 [GCAUGGGCCC 3 [was synthesised (Sigma Aldrich) and 5′ end labelled using γ32P UTP (Perking Elmer ...
-
bioRxiv - Genetics 2024Quote: ... then 5 IU of hCG (Millipore Sigma, Cat# 9002-61-3 C1063) 48 hr later ...
-
bioRxiv - Cell Biology 2024Quote: ... and siTGN46 with 5’-CCACCGAAAGCGUCAAGCAAGAAGA-3’ sequence were obtained from Sigma-Aldrich. Huh7-ACE2 cells were transfected with siRNA oligos (final concentration ...
-
bioRxiv - Cell Biology 2023Quote: ... The coverslips were treated for 5 min with APES (3-Aminopropyltriethoxysilane, Sigma) and thoroughly rinsed ...
-
bioRxiv - Cell Biology 2023Quote: ... blocked with 3% BSA in PBS and 5% Goat Serum (Sigma, #G9023) for 1h before being incubated with primary antibodies in 3% BSA in PBS for 1h ...
-
bioRxiv - Molecular Biology 2023Quote: ... siRNA sequences (5’ – 3’) are the following: Universal siRNA control (Sigma, SIC001)
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM 8-bromoadenosine 3′,5′ cyclic monophosphate sodium salt (Sigma-Aldrich), and 0.1 mM 3- isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Developmental Biology 2023Quote: ... including Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (8Br-cAMP, Sigma B7880), N6,2’-O-Dibutyryladenosine 3’,5’-cyclic monophosphate sodium salt (DB-cAMP ...
-
bioRxiv - Bioengineering 2024Quote: ... eGFP reverse: 5′-AAG TCG TGC TGC TTC ATG TG -3′ (Sigma); GAPDH forward ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and 0.5 mM 8-bromo-adenosine-3’,5’-cyclic monophosphate (Sigma-Aldrich) in Phenol-red free DMEM/F-12 medium (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... soft PDMS was incubated with 5% (3-Aminopropyl)triethoxysilane (Sigma-Aldrich, #281778) diluted in absolute ethanol for 3 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... N6,2-O-Dibutyryladenosine 3’,5’-cyclic monophosphate sodium salt (D0627, Sigma-Aldrich), and ascorbic acid ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lineage-labeling was induced at indicated time points using fresh or pre-heated (65°C for 10 min) 4-Hydroxytamoxifen (4-OHT) (Sigma H7904) stock solutions in DMSO at a final concentration of 10 μM in E3 embryo medium (Felker et al. ...
-
bioRxiv - Genetics 2020Quote: ... cells were fixed at day 4 of differentiation with 4% paraformaldehyde for 20 minutes at 4°C followed by permeabilization with 0.1% triton™X-100 (Sigma Aldrich) for 30 minutes at room temperature and blocking in 1xPBS with 1% fetal bovine serum (Gibco) ...
-
bioRxiv - Cancer Biology 2022Quote: Primary tumor samples and lungs were fixed in 4% paraformaldehyde (PFA) at 4°C for 24 h and decalcified in 14% EDTA (Sigma-Aldrich) for up to 56 d at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Brains were extracted and post-fixed for at least 1 day in 4% PFA at 4°C and transferred to 30% sucrose (Millipore Sigma) for at least 1 day at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... pH 7.4) for 1 hour at room temperature and then incubated at 4°C overnight with primary antibodies (anti-multicillin, Sigma Aldrich, HPA058073 1:500 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The fraction was incubated for 4 hours at 4°C with 250 μl of anti-FLAG M2 affinity resin (Sigma-Aldrich) equilibrated with lysis buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... centrifuged (500g at 4°C for 4 minutes) and resuspended in PBS containing 1 μg/mL DAPI (Sigma Aldrich, D9542-100MG). Analysis of flow cytometric data was preformed using the BD Fortessa X20 and FlowJo v10 software (Ashland) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... erythrogramma embryos were fixed for in-situ hybridization (ISH) for ∼16 hrs overnight at 4 °C in 4% paraformaldehyde (Sigma 158127) + 20 mM EPPS (Sigma E1894 ...
-
bioRxiv - Neuroscience 2023Quote: ... and fixed overnight at 4°C in phosphate buffer saline solution (PBS) containing 4% (vol/vol) paraformaldehyde (cat# P6148, Sigma-Aldrich). Layers of tissue containing the myenteric plexus were separated by microdissection ...
-
bioRxiv - Biochemistry 2022Quote: ... The soluble fraction was incubated for 4 hrs at 4 °C with 250 µL of anti-FLAG M2 affinity resin (Sigma-Aldrich) equilibrated with lysis buffer ...
-
bioRxiv - Immunology 2022Quote: ... The supernatants were collected and incubated for 4 h at 4 °C on a rotating wheel with 40 μl of packed anti-FLAG M2 affinity gel (Sigma, #A2220), which had been washed three times with lysis buffer prior to use ...
-
bioRxiv - Cancer Biology 2022Quote: Primary tumor samples and lungs were fixed in 4% paraformaldehyde (PFA) at 4°C for 24 h and decalcified in 14% EDTA (Sigma-Aldrich) for up to 28 d at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... Brains were extracted and post-fixed for 1 day in 4% PFA at 4°C before transferring to 30% sucrose (Millipore Sigma) in PBS at 4°C ...
-
bioRxiv - Genetics 2020Quote: ... 3 mg of each compound was dissolved in 6 mL hexane (Sigma-Aldrich #139386-500ML) and 0.5 mL was pipetted into individual 2 mL glass vials fitted with 9mm PTFE lined caps (Agilent Crosslab ...
-
bioRxiv - Biochemistry 2020Quote: ... The complex was then concentrated to 3-6 mg/ml (Amicon 100 kDa cutoff, Millipore) and loaded onto a size-exclusion column equilibrated with 20 mM HEPES ...
-
bioRxiv - Genetics 2022Quote: ... 3 mg of each compound was dissolved in 6 mL hexane (Sigma-Aldrich #139386-500ML) and 0.5 mL was pipetted into individual 2 mL glass vials fitted with 9mm PTFE lined caps (Agilent Crosslab ...
-
bioRxiv - Microbiology 2021Quote: ... 6×104 HPMEC or 2×105 Calu-3 cells were seeded on 0.2% gelatin-(Sigma) coated glass coverslips in 24-well plates ...
-
bioRxiv - Physiology 2021Quote: ... 6 corneas from 3 individuals were pooled in 100 μl of Tri reagent (T9424, Sigma). RNA was isolated from TRI reagent (T9424 ...
-
bioRxiv - Immunology 2023Quote: ... the peroxidase substrate ABTS (2,2’-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt, Sigma, A1888) was added and the absorbance determined at 405nm ...
-
bioRxiv - Genetics 2023Quote: ISE6 cells (3×106 cells per well) were plated in 6-well plates (Millipore Sigma) and stimulated accordingly ...
-
bioRxiv - Molecular Biology 2024Quote: ... 6 or 8 h with 500 µM Indole-3-Acetic Acid (IAA, Sigma-Aldrich #I5148). For induction of Oct4 knockdown in ZHBTc4 cells ...
-
bioRxiv - Biochemistry 2024Quote: ... N-(3-oxododecanoyl)-L-homoserine lactone (AHL-C12) and 6-methoxyflavanone were purchased from Sigma. Stock solutions of these compounds (DPH ...
-
bioRxiv - Biophysics 2024Quote: ... 6-well plates were pre-treated with 1% (3-aminopropyl)triethoxysilane (APTES, Sigma-Aldrich, Germany) in milliQ water ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 4×10-4 M monothioglycerol (Sigma)) with BMP4 (1 ng/ml ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4-nitroquinoline 1-oxide (4-NQO) (Sigma). Treatment conditions are indicated in the corresponding figures ...
-
bioRxiv - Genomics 2020Quote: ... and 4 × 10−4 M monothioglycerol (Sigma). Media and cytokines were changed daily as follows (Gadue et al. ...