Labshake search
Citations for Millipore Sigma :
1601 - 1650 of 10000+ citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... 75 μg of sample was incubated at 4°C overnight on rotator with 5 μg mouse anti-puromycin antibody (Millipore Sigma: MABE343), or rabbit anti-eIF4E (Abcam ...
-
bioRxiv - Neuroscience 2024Quote: ... and probed with the following antibodies (diluted in 5% milk in PBST) overnight at 4 °C: α-Tubulin (1:400000, Sigma t9026), α-Dnmt3a (1:5000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Post-fixation and sequential decalcification were carried out at 4°C by immersing in the same fixative and with the addition of 5% EDTA (Sigma-Aldrich, US) for 5 hours each ...
-
bioRxiv - Physiology 2023Quote: ... Fixed cells were blocked and permeabilized overnight at 4°C in block solution (1x PBS + 5% bovine serum albumin (Sigma-Aldrich #A3803) + 0.5% Triton-X-100) ...
-
bioRxiv - Cancer Biology 2023Quote: ... were recovered from Matrigel using 3 mM EDTA in DPBS, washed, centrifuged (200g, 5 min, 4°C) and lysed with 1x RIPA buffer supplemented with PPI (1:100, Sigma- Aldrich, 04693132001), and benzonase (1:100 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Chromatin from about 1.5×106 cells was incubated overnight at 4°C with 2–5 μg antibodies to FLAG epitope (M2; Sigma-Aldrich, #F1804, RRID:AB_262044), BRD4 (Cell Signaling Technology ...
-
bioRxiv - Biochemistry 2024Quote: ... blotted and incubated overnight in 5% skim milk (GERBU Biotechnik, 70166) in TBST at 4°C with an anti-RAS antibody (Millipore, 05-516). As a loading control ...
-
bioRxiv - Developmental Biology 2024Quote: ... differentiation day 18 control and proximal-biased organoids were incubated at 37°C/5% CO2 for 4 hours in TeSR-E6 supplemented with 10 µg/mL TRITC-albumin (Sigma Aldrich, A2289). Control organoids were incubated with TeSR-E6 alone ...
-
bioRxiv - Neuroscience 2024Quote: ... Retinas were quenched in 100 mM glycine in 1X PBS for 30 min at 4°C and then incubated in SUPER block buffer (15% NGS, 5% bovine serum albumin (BSA) (Sigma, Cat# B6917) + 0.5% BSA-c (Aurion ...
-
bioRxiv - Bioengineering 2024Quote: ... have been colored with either Solvent Yellow 7 or with Solvent Green 3 (Sigma-Aldrich, St. Louis, MO) at concentrations of 0.50 mg/mL and 1.43 mg/mL respectively ...
-
bioRxiv - Genomics 2023Quote: ... The oxidation (5 equiv) was carried out with 0.05 M iodine in pyridine (BI0424-1005, Sigma-Aldrich). The detritylation step was performed using 3% dichloroacetic acid in toluene (BI0832-2505 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Other reagents used in this study included 5-chloro-2’-deoxyuridine (CldU, Sigma-Aldrich C6891), 5-Iodo-2’-deoxyuridine (IdU ...
-
bioRxiv - Molecular Biology 2023Quote: ... hESCs medium with 25 μM 5-chloro-2′-deoxyuridine (CldU; Sigma-Aldrich, St. Louis, MO) was added to the cultures ...
-
bioRxiv - Molecular Biology 2021Quote: A CU RNA hairpin (5’-AAAAGAAAAGACGCGUAGUUUUCUACGCG- 3’) labeled with Cyanine 5.5 at the 5’-end (Millipore Sigma) was annealed in 20 mM HEPES ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Polη (5’GCAAUGAGGGCCUUGAACA3’ from sigma-Aldrich) and Rev1 (5’CAGCGCAUCUGUGCCAAAGAA3’ from Sigma-Aldrich). For control ...
-
bioRxiv - Molecular Biology 2020Quote: ... the ERS alleviator 4-phenyl butyric acid (4-PBA, 5 mM) and the ATF6 inhibitor Ceapin-A7 (500 nM) were purchased from Sigma-Aldrich. Chondrocytes were cultured in DMEM supplemented with Tm or Tg for 6 h ...
-
bioRxiv - Immunology 2024Quote: ... or irrelevant mouse monoclonal anti-c-myc antibody (9E10) at 3 µg/ml (Sigma) was added and incubated for 1 hour at room temperature with shaking ...
-
bioRxiv - Microbiology 2023Quote: The small interfering RNAs (siRNAs) against NLRP3 (siNLRP3) (5’-UGCAAGAUCUCUCAGCAAA-3’) and the corresponding control siRNAs (siControl) (5’-UUCAAUAAAUUCUUGAGGU-5’) were synthesized from Sigma. The siGenome smart pool siRNAs and siON Target plus siRNAs were purchased from Dharmacon and are composed of a pool of four siRNAs ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3-5 colonies were picked and incubated in 2mL Terrific Broth (T0918, Sigma) containing 100µg/mL Ampicillin for 8 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437, Sigma Aldrich) for 24 hours prior to collection of cells for RNA extraction.
-
bioRxiv - Biochemistry 2022Quote: ... or 100nM of synthetic RNA [45-mer: 5′ GGGUCAACGUGGGCAAAGAUGUCCUAGCAAGCCAGAAUUCGGCAG −3′] generated by Sigma. In reactions where CifA was co-present with CifB ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1µl of each primer (10µm, 5’: FAATGGCAGAGTGGGGTTGGG, 3’: CGGCAAACGGACAGAAGCATT, Sigma-Aldrich, USA).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Membranes were washed 3×5 min with 0.1% Tween® 20 (Sigma-Aldrich) in TBS before a 1 hour incubation with a 1:5,000 dilution of sheep anti-mouse IgG horseradish perodixase secondary antibody (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... The probe used was as follows: 5’[6FAM]AGACTAATTCTCCTCGGCGGGCACG[TAM]3’ (Sigma Aldrich). Analysis was performed using the Rotor-Gene 6000 Series Software 1.7 (Corbett Life Sciences ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 dpf larvae were exposed to 3 μM CuSO4 (Sigma-Aldrich, Cat# 451677) diluted in EM in cell strainers (Corning ...
-
bioRxiv - Neuroscience 2022Quote: ... incubated in blocking solution (3% skimmed milk or 5% BSA (Sigma-Aldrich, A9647) in TBS + 0.01% Tween20 (Sigma ...
-
bioRxiv - Pathology 2023Quote: ... washed in TBS (3 × 5 min) and blocked in 1% BSA (Sigma Aldrich) in TBST (0.1% Tween-20 in TBS) ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-(4,5-dimethylthiazol-2-Yl)-Diphenyltetrazolium Bromide (MTT, CT01-5, Sigma-Aldrich, UK) stock solution was diluted in F12 medium without phenol red (1:5) ...
-
bioRxiv - Genetics 2023Quote: ... beads were washed 3 times 5 minutes with lysis buffer (Sigma-Aldrich, L3412) on a rotator and protease and phosphatase inhibitors ...
-
bioRxiv - Cell Biology 2024Quote: ... and next 3 chamber volumes of 5 mg/ml κ-casein (Sigma, C0406) dissolved in MRB80 ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µL of Pellet Paint NF Co-precipitant (Sigma Millipore Cat. # 70748-3) and 500 µL of Sodium Acetate (pH 5.2 ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µL of Pellet Paint NF Co-precipitant (Sigma Millipore Cat. # 70748-3) and 500 µL of Sodium Acetate (pH 5.2 ...
-
bioRxiv - Cell Biology 2024Quote: ... Treated films were immediately incubated in 5% (3-Aminopropyl)triethoxysilane (APTES, Sigma, 440140) in ethanol (dark ...
-
bioRxiv - Cell Biology 2021Quote: ... 150 μM 4-(4-Morpholinobutylthio)phenol (MoTP) (Sigma) was added to embryos kept at 28.5°C from 24hpf onwards ...
-
bioRxiv - Biochemistry 2020Quote: ... and 4×10^-4 1-Thioglycerol (Sigma Aldrich), and incubated for 72 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... 4-AP (4-Aminopyridine, 500 μM, Sigma-Aldrich), FK-506 (1 μM ...
-
bioRxiv - Neuroscience 2021Quote: ... 4-Hydroxytamoxifen (4-OHT) was purchased from Sigma and dissolved in ethanol ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4-hydroxy tamoxifen (4-OHT, Sigma-Aldrich, H6278) treatment (1 µM in EtOH ...
-
bioRxiv - Immunology 2021Quote: 4-hydroxytamoxifen (Tx) (4-OHT, #T5648, Sigma-Aldrich) was dissolved in sunflower oil to a concentration of 10 mg/mL for i.p ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μM 4-hydroxy tamoxifen (4-HT; Sigma) was added at the time of activation.
-
bioRxiv - Neuroscience 2022Quote: (Z)-4-Hydroxytamoxifen (4-OHT; Sigma-Aldrich #H7904) was first prepared as 25 mg/mL stock solutions in ethanol and frozen at −20C ...
-
bioRxiv - Neuroscience 2024Quote: ... and 4-aminopyridine (4-AP, 100 μM, Sigma), mecamylamine (10 μM ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 mM MgCl2 and 4% DMSO (Sigma, 276855). The mixture was incubated for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... Chemicals used: 4-Aminopyridine (4-AP, Sigma #A78403), tetrodotoxin (TTX ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4-hydroxytamoxifen (4-OHT, Cat#: H7904, Sigma-Aldrich) was dissolved at 10mg/ml in peanut oil and 1mg was administered by intraperitoneal injection from E10.5 for 4 consecutive days ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-hydroxytamoxifen (4-OHT; 1 μM; #H7904 Sigma) or vehicle was added to the cell culture medium to activate Cre-LoxP recombination ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxytamoxifen (4-OH TAM, Sigma-Aldrich, H7904), L-selenocystine (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2024Quote: ... 6 and 7% acrylamide:0.03% bis-acrylamide (Sigma-Aldrich) were allowed to polymerize between the activated surface of hydrophilic coverslips and a hydrophobic glass slide for 25 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... The antibody reaction was visualized with 3-3’ diaminobenzidine (Sigma, D8001) followed by counterstaining with hematoxylin ...
-
bioRxiv - Neuroscience 2022Quote: ... prior to being rinsed and reacted using 3-3’diaminobenzidine (Sigma) as chromagen ...