Labshake search
Citations for Millipore Sigma :
1151 - 1200 of 10000+ citations for Tert Butyldimethyl 3 4 4 5 5 Tetramethyl 1 3 2 Dioxaborolan 2 Yl Phenoxy Silane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-alpha-tubulin (Clone B-5-1-2) (1:1000, Sigma, Cat# T5168), and mouse anti-PyCSP (1:1000 ...
-
bioRxiv - Microbiology 2020Quote: ... and mouse anti-α-tubulin 1:10,000 (monoclonal B-5-1-2, Sigma-Aldrich). To image the blot the secondary antibodies goat anti-rabbit IgG IRDye 800CW (LI-COR ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary antibodies used were: α-Tubulin (Sigma, B-5-1-2; T5168, 1:100,000), MCM2 (Abcam ...
-
bioRxiv - Cell Biology 2020Quote: ... The surfaces were then incubated with 5% (3-Aminopropyl)trimethoxysilane (Sigma) in ethanol for 5 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... CHIR99021 (3 μM) and LY411575 (5 μM, Sigma-Aldrich, no. SML0506). Culture media was changed every other day.
-
bioRxiv - Neuroscience 2021Quote: ... as control siRNA for luciferase was used (5’-UAAGGCUAUGAAGAGAUAC-3’; Sigma). Immediately before transfection 2×106 cells were seeded in 6-well plates in 1.4 ml of medium containing 10% fetal serum ...
-
bioRxiv - Bioengineering 2021Quote: ... 5□μL 3-aminopropyltriethoxysilane (APTES) 99% (Sigma-Aldrich cat. no. 440140) was added ...
-
bioRxiv - Bioengineering 2022Quote: ... The PDMS parts were submerged in a 5% 3-aminopropyltriethoxysilane (Sigma) solution to generate surface amine ...
-
bioRxiv - Neuroscience 2021Quote: ... reversely transfected (human siTDP 5’-GCAAAGCCAAGAUGAGCCU-3’, Sigma-Aldrich or siLUC) and harvested 48 h later ...
-
bioRxiv - Microbiology 2022Quote: ... Pectinase activity by the 3’,5’-dinitrosalicylic acid (DNS) (Sigma-Aldrich) method (Miller ...
-
bioRxiv - Molecular Biology 2022Quote: ... (5’-CACGGGACAGCCTGAGCGGAACGGTGCTAATCGTGCGGT-3’) strand of e5 probe were synthesized (Sigma-Aldrich) and sense strand was end labelled with [γ32P] ATP using T4 polynucleotide kinase according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... 40 nM of siTDP (mouse siTDP 5’-CGAUGAACCCAUUGAAAUA-3’, Sigma-Aldrich) or non-targeting siLUC (5’-UAAGGCUAUGAAGAGAUAC-3’ ...
-
bioRxiv - Genomics 2022Quote: ... PNP-GMP (guanosine 5′-[β,γ-imido]triphosphate, 3 mM, Sigma) was included in the lysis buffer of TIS(Ret ...
-
bioRxiv - Neuroscience 2023Quote: ... CHIR99021 (3 μM) and LY411575 (5 μM, Sigma-Aldrich, no. SML0506)].
-
bioRxiv - Genetics 2023Quote: ... and 1µM adenosine 3’,5’-cyclic monophosphate (cAMP)(Millipore Sigma, #A9501). To aid in cell atachment ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.1 mM 8-Bromoadenosine 3′,5′-cyclic monophosphate sodium salt (Sigma), and 0.1 mM IBMX (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... We implanted 5×105 EO771 (ATCC) or AT-3 (EMD Millipore) mouse mammary tumor cell lines and 1×105 mouse mammary fibroblasts orthotopically into 4th inguinal mammary fat pads of 6-8-week-old female C57BL/6J female mice (The Jackson Laboratory)(46) ...
-
bioRxiv - Cell Biology 2023Quote: ... cloned 5’-NdeI to 3’-NotI into pET21a(+) (Novagen, Madison, WI) (pET21a-APOL7C::FLAG::1XHis) ...
-
bioRxiv - Immunology 2024Quote: ... centrifuged for 5 min at 500 g (Centrifuge 3-18KS, Sigma), then resuspended in full media to a concentration of 1 × 106 cells/mL and distributed in 96-well plates (100 μL/well) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2.5 µM Oligo-dT primer (5’-AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTT-TTVN-3’, Sigma-Aldrich)) using FACSAria Fusion cytometer (BD Biosciences ...
-
bioRxiv - Cancer Biology 2024Quote: ... Small interfering RNAs (siRNAs) included Non-targeting: 5’-GAUCAUACGUGCGAUCAGATT-3’ (Sigma), NT5E ...
-
bioRxiv - Cell Biology 2024Quote: ... Faf2-targeting (5’-AGAAAGCGAAGCTCCCTTTTGG-3’, Millipore Sigma, Sanger library clone HS5000006660) AGPS-targeting (5’-ATAAAAATGGTAACACCTAG-3’ ...
-
bioRxiv - Cell Biology 2024Quote: ... for 3 h or 5 μM ionomycin (Sigma-Aldrich Cat#407950) for 15 min prior to imaging ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by 1 h in 1% osmium tetroxide in H2O and dehydration in an ethanol gradient (30%, 60%, 90%, 4×100% for 5 min each) and chemical drying in hexamethyldisilazane twice for 2 min (Sigma-Aldrich, Oslo, Norway). Before imaging samples were mounted on aluminum stubs and coated with 10 nm layer of gold/palladium alloys.
-
bioRxiv - Biophysics 2020Quote: ... 1 mM EDTA with freshly added 1 mM DTT), then concentrated to 500 μl using Amicon Ultra-4 (4 mL, 3 kDa cut-off) (Millipore, Darmstadt, Germany, UFC800324) and loaded onto a Superdex75 10/300 GL size exclusion column (GE Healthcare ...
-
bioRxiv - Molecular Biology 2021Quote: ... to YPD containing 5 mM 4-thiouracil (Sigma, 440736-1G). Cells were incubated with 4tU for 5 minutes before pelleting (one minute ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 dpf larvae were fixed in 4% paraformaldehyde (PFA; Sigma) in phosphate-buffered saline (PBS ...
-
bioRxiv - Immunology 2020Quote: ... 4 or 6 h with staurosporine (5 µg/ml, Sigma) at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 ng/ml of mouse recombinant IL-4 (Sigma-Aldrich), and 0.5 μg/ml anti-CD180 (RP/14 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 ng/ml mouse recombinant IL-4 (Sigma-Aldrich) to allow B cell activation and class switch recombination to IgG1 ...
-
bioRxiv - Neuroscience 2022Quote: ... 100μm of 4-AP (Sigma-Aldrich, CAS#: 504-24-5) was washed on for 3 minutes (the amount of time it took to regularly induce 4-AP oscillations ...
-
bioRxiv - Developmental Biology 2023Quote: ... followed by fixation in 4% formaldehyde (EMD Millipore FX0410-5) in 1X PBS with Triton X-100 (0.3% ...
-
bioRxiv - Immunology 2024Quote: ... or 4 mM EGTA (CAS 67-42-5, Sigma-Aldrich) were added to buffers as outlined in the text.
-
bioRxiv - Cancer Biology 2024Quote: ... and 5 μL of thrombin (4 units/ml, Sigma, UK) were mixed ...
-
bioRxiv - Neuroscience 2024Quote: ... 5′-cyclic monophosphate (dibutyryl cAMP) (Sigma-Aldrich, 60-92-4) and 2 ng/mL GDNF (Pepro Tech ...
-
bioRxiv - Molecular Biology 2021Quote: A CU RNA hairpin (5’-AAAAGAAAAGACGCGUAGUUUUCUACGCG- 3’) labeled with Cyanine 5.5 at the 5’-end (Millipore Sigma) was annealed in 20 mM HEPES ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Polη (5’GCAAUGAGGGCCUUGAACA3’ from sigma-Aldrich) and Rev1 (5’CAGCGCAUCUGUGCCAAAGAA3’ from Sigma-Aldrich). For control ...
-
bioRxiv - Plant Biology 2023Quote: ... SD-WLH plates were supplemented with either 2.5 or 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2024Quote: ... 5’ – CACCGCCGCCTCCGCGCTTCCCCGA – 3’ PIEZO1_sgRNAact_TSS143 (guide 3): 5’ – CACCGAGGCCCCAACGCACCAGGGC – 3’ Modified U251 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; D5796, Sigma), supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2021Quote: ... MTs were labeled with rat monoclonal antibody YL 1/2 directed against tyrosinated -tubulin (1:1000, Millipore), or rabbit polyclonal antibody against detyrosinated -tubulin (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM 2-amino-5-phosphonopentanoic acid and 100 U/ml DNase (DN25, Sigma) for 25 min ...
-
bioRxiv - Biochemistry 2024Quote: ... Sprtn KO was induced by treating 4×105 cells with methanol (MeOH) (vehicle control) or 2 μM (Z)-4-hydroxytamoxifen (4-OHT) (Sigma) for 48 h ...
-
bioRxiv - Immunology 2023Quote: ... 4 weeks after BM transplantation animals were injected with 5-FU (5-fluorouracil F6627, Sigma-Aldrich) at a dose of 150 mg/kg in 100ul of PBS ...
-
bioRxiv - Immunology 2024Quote: ... followed by 4 - 5 hours of stimulation by phorbol myristate acetate (PMA, 5 ng/ml, Sigma) and ionomycin (500 ng/ml ...
-
bioRxiv - Microbiology 2021Quote: ... Cell pellets were lysed in 3 ml BugBuster HT (Millipore, #70922-4) for 30 min at room temperature on a rotator ...
-
bioRxiv - Pathology 2021Quote: ... N″-triacetylchitotrioside [4-MU-β-(GlucNAc)3] (Sigma, St. Louis, MO, USA) as the substrate ...
-
bioRxiv - Neuroscience 2023Quote: ... D-Cyc (D-4-amino-3-isoxazolidone, 20 μg/μl; Sigma-Aldrich), AP5 (2-amino-5-phosphonopentanoate ...
-
bioRxiv - Neuroscience 2023Quote: ... testosterone-filled (4-androsten-17β-ol-3-one, Sigma Aldrich T-1500) Silastic tubes (2.16 OD x 1.02 ID ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... obtained by diluting testosterone (4- androsten-17b-ol-3-one; Sigma #86500) in commercial sesame to a concentration of 4 µg/µL ...
-
bioRxiv - Bioengineering 2024Quote: ... (4) the same supplemented with 3 μM free chloroquine diphosphate (Millipore Sigma), (5 ...