Labshake search
Citations for Millipore Sigma :
951 - 1000 of 10000+ citations for Tert Butyldimethyl 3 4 4 5 5 Tetramethyl 1 3 2 Dioxaborolan 2 Yl Phenoxy Silane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... 2.5mM Na3VO4 and 1% each of phosphatase inhibitor cocktails 2 and 3 (Sigma) and set on ice for 10 minutes prior to sonication ...
-
bioRxiv - Molecular Biology 2023Quote: ... at a ratio of 3:2:1 in HEK 293T cells (Sigma Aldrich) using Lipofectamine 2000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 mM PMSF and phosphatase inhibitor cocktail 2 and 3 from Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 to 3 million cells were cross-linked using 1% formaldehyde (Sigma, F8775) for 10 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1% each phosphatase inhibitor cocktails 2 and 3 (Sigma Cat #P5726 and P0044). Lysates were cleared at 17,000g ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 mM PMSF and phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich, Switzerland). The insoluble fraction was then sonicated using a fine probe 15 times at 0.5 sec pulse at an amplitude of 20% ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 1 mM EDTA) supplemented with phosphatase inhibitor cocktail 2 and 3 (Sigma), and protease inhibitor cocktail (cOmplete Protease Inhibitor ...
-
bioRxiv - Cell Biology 2020Quote: ... and 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Sigma H0887).
-
bioRxiv - Cell Biology 2021Quote: ... Sporozoites were fixed with 4% formalin solution (SIGMA, Cat# HT50-1-2) for 20 min at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... and DAPI (4’,6-diamino-2-phenylindole) (D9542; Sigma; 1 μg/mL). Additionally ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Sigma H0887). These cells were chosen as an experimental system as previously described (Massacci et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... Treatment with HU (Sigma-Aldrich, 0, 0.5, 1, 2, 4, 8 mM) was for 24h ...
-
bioRxiv - Cell Biology 2024Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI) (1:10000, D8417, Sigma-Aldrich).
-
bioRxiv - Bioengineering 2023Quote: ... Confluent monolayers were treated with 8-(4-chlorophenylthio)adenosine 3′,5′-cyclic monophosphate sodium salt (cPT-cAMP; Sigma-Aldrich, cat# C3912, 25-250 µM) Ro 20-1724 (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2024Quote: ... Phosphatase activity was determined by a chromogenic reaction using 5-bromo-4 chloro-3 indolyl phosphate and nitroblue tetrazolium (Sigma, St. Louis, MO, USA) as substrates.
-
bioRxiv - Immunology 2024Quote: ... The reaction was visualized by subsequent addition of BCIP/5-bromo-4-chloro-3-indolylphosphate/nitro blue tetrazolium substrate (Sigma-Aldrich Cat#B5655-5TAB). The number of spots was determined using a CTL ImmunoSpot S5 UV Analyzer equipped with ImmunoSpot ImmunoCapture and ImmunoSpot Counting software (Cellular Technology Ltd. ...
-
bioRxiv - Developmental Biology 2020Quote: ... newly hatched or decapsulated tadpoles were immersed in a 500 μM solution of the fluorophore 4-(4-diethylaminostyryl)-1-methylpyridinium iodide (4-di-2-ASP, Sigma D-3418, sigmaaldrich.com) for five minutes at room temperature in the dark ...
-
bioRxiv - Bioengineering 2022Quote: ... and 2 μl of trimethoxy(propyl)silane (TMPS) (Sigma Aldrich, 662275) was added to the MPTMS-modified AuNRAg to form the polymer spacer layer ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2/3 mTeSR1 + 1/3 N2 medium + LSX + PSD Day 6,7: 1/3 mTeSR1 + 2/3 N2 medium + PSD At day 6 cells were detached by Accutase solution (Sigma-Aldrich) and incubated at 37°C for 20 minutes to obtain a single cell suspension ...
-
bioRxiv - Immunology 2022Quote: ... 5 μM oligomycin and 100 mM 2-deoxyglucose (2-DG) (Sigma-Aldrich) were injected to each well after 18 ...
-
bioRxiv - Genomics 2023Quote: ... then quickly was cut to small pieces (1-3 mm) in petri dish with 3 -5 ml RMPI medium containing 0.05mg/ml TM Liberase (Sigma Aldrich, 5401119001) and 0.02 mg/ml DNAaseI (ThermoFisher ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 × 5 minutes each and were mounted using Fluorosave (Millipore) before imaging ...
-
bioRxiv - Immunology 2021Quote: ... siRNA-TDP-43 D: 5’-GAAACAAUCAAGGUAGUAA[dT][dT]-3’ (Sigma)4 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 × 10−3 g/L human insulin (Sigma Aldrich, USA), 5 × 10−5 M hydrocortisone (Upjohn Laboratories SERB ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse Primer 5’-TGGTTGAGCACAGGGTACTT-3’] were synthesized by Sigma-Aldrich, USA ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgCl2 and phosphatase (phosphatase inhibitor cocktail 3, Sigma) and protease inhibitors (EDTA free cOmplete™ protease inhibitors ...
-
bioRxiv - Cell Biology 2021Quote: ... (3) TGFβ2 (5 ng/ml) + GsMTx4 (500 nM; Sigma-Aldrich), or (4 ...
-
bioRxiv - Physiology 2022Quote: ... 3 nM 3,3’,5-Triiodo-L-thyronine sodium salt (Sigma), 10 ng/ml EGF (Sigma) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membranes were blocked in 3-5% skimmed milk (Sigma) dissolved in Tris buffered saline + 0.2% v/v Tween-20 (TBST) ...
-
bioRxiv - Immunology 2024Quote: ... reverse primer (5’-3’): GACGGTGCCATGGAATTTGC) and purchased from Sigma-Aldrich. RT-qPCR was performed with gene-targeted primers using TB Green Premix Ex Taq II (Tli RNase H Plus ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 mM 3-indol-acetic acid (IAA; Sigma-Aldrich, I2886) was added 1 h prior to adding phleomycin or β-estradiol.
-
bioRxiv - Cancer Biology 2024Quote: ... cells were exposed to 3-Methyladenine (5 mM; Sigma, M9281) for 24 hours ...
-
bioRxiv - Biophysics 2022Quote: ... were silanized using a 2:1:80 solution of acetic acid/bind- silane (M6514, Sigma)/ethanol for 30 min ...
-
bioRxiv - Immunology 2020Quote: ... for 4 hrs and 5 mM ATP (Sigma, A26209) for different periods up to 4 hours.
-
bioRxiv - Genomics 2022Quote: ... 4 mL of 5 mM IBMX (Sigma, #I-5879), 1 ng/mL Heparin (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... rabbit anti-aquaporin 4 (Sigma Millipore, 5 μg/ml), rabbit anti-aquaporin 5 (Sigma Millipore ...
-
bioRxiv - Immunology 2023Quote: ... rabbit anti-aquaporin 4 (Sigma Millipore, 5 μg/ml), rabbit anti-aquaporin 5 (Sigma Millipore ...
-
bioRxiv - Plant Biology 2024Quote: ... and subsequently incubated with rat monoclonal anti-tubulin YL-1/2 antibody (Sigma-Aldrich) at 1:100 dilution ...
-
bioRxiv - Genetics 2023Quote: ... beads were rewashed 3 times 5 minutes with 1× wash buffer (Sigma-Aldrich, W0390) on a rotator and with protease and phosphatase inhibitors ...
-
bioRxiv - Cancer Biology 2023Quote: ... from QIAGEN or costume siRNA against MdmX (siMdmX#1, sequence: 5’-AGAUUCAGCUGGUUAUUAA-3’) from Sigma-Aldrich. For Spry4 knockdown cells were transfected with a pool of 3 siRNAs against Spry4 (s37824 ...
-
bioRxiv - Biochemistry 2022Quote: ... they were cultivated 72 hours in the presence of 2 μM DL-threo-1-phenyl-2-palmitoylamino-3-morpholino-1-propanol (PPMP) (Sigma-Aldrich) to inhibit the synthesis of glucosylceramide-based GSLs 75 and incubated with fluorescent SaroL-1 as previously described ...
-
bioRxiv - Bioengineering 2023Quote: ... was coated with a 4:1:5 v/v/v collagen IV (Sigma) / fibronectin (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse α-Tubulin (Sigma, B-5-1-2, # T5168, used at 1:5000), mouse α-FLAG (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-α tubulin (T5168, B-5-1-2, Sigma-Aldrich, 1:1000). Rabbit anti-Solo antibody was purified using an immunogen peptide conjugated-Sepharose column from the antiserum ...
-
bioRxiv - Neuroscience 2024Quote: ... Those reduced thiols were then labelled with 7-diethylamino-3-(4’-maleimidylphenyl)-4-methylcoumarin (CPM; Sigma Aldrich) for 30 min ...
-
bioRxiv - Microbiology 2023Quote: The small interfering RNAs (siRNAs) against NLRP3 (siNLRP3) (5’-UGCAAGAUCUCUCAGCAAA-3’) and the corresponding control siRNAs (siControl) (5’-UUCAAUAAAUUCUUGAGGU-5’) were synthesized from Sigma. The siGenome smart pool siRNAs and siON Target plus siRNAs were purchased from Dharmacon and are composed of a pool of four siRNAs ...
-
bioRxiv - Bioengineering 2022Quote: 4-Nitrophenyl β-D-glucuronide (4-NPG, CAS no. 10344-94-2) (Sigma-aldrich) was prepared in 50 mM sodium phosphate buffer (Na-PB ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sesamol and 3′,4′-(Methylenedioxy) acetophenone were purchased from Sigma-Aldrich. All the analytical grade chemicals were procured from Merck Limited ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 mM 4-MU N-acetyl-β-D-glucosaminide (Sigma Aldrich) in 200 mM sodium citrate buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 mM 4-MU N-acetyl-β-D-glucosaminide (Sigma Aldrich) in 200 mM sodium citrate buffer ...