Labshake search
Citations for Millipore Sigma :
1351 - 1400 of 10000+ citations for Tert Butyldimethyl 3 4 4 5 5 Tetramethyl 1 3 2 Dioxaborolan 2 Yl Phenoxy Silane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 6 – diamidino – 2 – phenylindole (DAPI) (Sigma, USA, 4 µg/mL) and 2-mercaptoethanol (2 µl/mL) ...
-
bioRxiv - Cell Biology 2023Quote: ... Nuclear counterstaining using DAPI (4’,6-diamino-2-phenylindole) (Sigma) was carried out ...
-
bioRxiv - Immunology 2024Quote: ... incubated with DAPI (4′,6-diamidino-2-phenylindole) (Sigma D9542) for 15 min ...
-
bioRxiv - Microbiology 2024Quote: ... the indicator 4-(2-pyridylazo)resorcinol (PAR) (Sigma Aldrich, Germany) was used ...
-
bioRxiv - Neuroscience 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Sigma, Cat. No. D9542) was added to the second wash to label nuclei ...
-
bioRxiv - Bioengineering 2024Quote: ... titanium(IV) isoproproxide (Ti[OCH(CH3)2]4) (Sigma Aldrich), citric acid (HOC(COOH)(CH2COOH)2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... together with DAPI (4’,6-diamidino-2-phenylindole, Sigma-Aldrich) for 1 hour at room temperature in the dark ...
-
bioRxiv - Systems Biology 2024Quote: ... lysates were reduced with 5 mM 5-tris(2-carboxyethyl)phosphine hydrochloride (TCEP) (Sigma-Aldrich) for 2 min at room temperature ...
-
bioRxiv - Bioengineering 2022Quote: ... primary antibodies were prepared at 1:100 in a 1:4 blocking solution (2% BSA (Sigma), 10% normal goat serum (Life Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... 1% BSA at 4 °C overnight: rabbit anti-microtubule-associated protein 2 (MAP2, Millipore 1: 200); sheep polyclonal anti-dopamine beta hydroxylase (DBH ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Pol κ (Polκ3’) (5’ACUCCAGCCUGAAGAGCGA3’ from Sigma-Aldrich), USP7 (5’CCCAAAUUAUUCCGCGGCAAA3’ from Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... washed 3 × 5 min in PBS with 0.1% Tween (both Sigma Aldrich) and probed for 1 h at room temperature in the dark with IRDye® conjugated secondary Abs against goat IgG (800CW ...
-
bioRxiv - Immunology 2021Quote: ... Scrambled non-targeting siRNA (5’-AAUUCUCCGAACGUGUCACGU-3’) was used as control (Sigma). Briefly ...
-
bioRxiv - Molecular Biology 2023Quote: ... siRNA sequences (5’ – 3’) are the following: Universal siRNA control (Sigma, SIC001)
-
bioRxiv - Developmental Biology 2024Quote: ... 0.1 mM 8-Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (Sigma, No.B7880) and 0.1 mM 3-Isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Cell Biology 2024Quote: ... and siTGN46 with 5’-CCACCGAAAGCGUCAAGCAAGAAGA-3’ sequence were obtained from Sigma-Aldrich. Huh7-ACE2 cells were transfected with siRNA oligos (final concentration ...
-
bioRxiv - Genetics 2024Quote: ... then 5 IU of hCG (Millipore Sigma, Cat# 9002-61-3 C1063) 48 hr later ...
-
bioRxiv - Molecular Biology 2024Quote: Sym/Sub RNA with sequence 5 [GCAUGGGCCC 3 [was synthesised (Sigma Aldrich) and 5′ end labelled using γ32P UTP (Perking Elmer ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM 8-bromoadenosine 3′,5′ cyclic monophosphate sodium salt (Sigma-Aldrich), and 0.1 mM 3- isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Developmental Biology 2023Quote: ... including Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (8Br-cAMP, Sigma B7880), N6,2’-O-Dibutyryladenosine 3’,5’-cyclic monophosphate sodium salt (DB-cAMP ...
-
bioRxiv - Cell Biology 2023Quote: ... The coverslips were treated for 5 min with APES (3-Aminopropyltriethoxysilane, Sigma) and thoroughly rinsed ...
-
bioRxiv - Cell Biology 2023Quote: ... blocked with 3% BSA in PBS and 5% Goat Serum (Sigma, #G9023) for 1h before being incubated with primary antibodies in 3% BSA in PBS for 1h ...
-
bioRxiv - Bioengineering 2024Quote: ... eGFP reverse: 5′-AAG TCG TGC TGC TTC ATG TG -3′ (Sigma); GAPDH forward ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and 0.5 mM 8-bromo-adenosine-3’,5’-cyclic monophosphate (Sigma-Aldrich) in Phenol-red free DMEM/F-12 medium (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... soft PDMS was incubated with 5% (3-Aminopropyl)triethoxysilane (Sigma-Aldrich, #281778) diluted in absolute ethanol for 3 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... N6,2-O-Dibutyryladenosine 3’,5’-cyclic monophosphate sodium salt (D0627, Sigma-Aldrich), and ascorbic acid ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were incubated for 3 days at 4°C with rabbit anti-AVP (1:2,000, Sigma, PC234L) or rabbit anti-Ntng1 (1:1,000 ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were passaged at 1/8 ratio every 3 or 4 days with Accumax (Millipore, ref. SCR006).
-
bioRxiv - Plant Biology 2021Quote: ... 600 μl 4% acetic acid with 20 μl 1mM phosphodiesterase inhibitor 3-isobutyl-1-methylxanthine (IBMX, Sigma) and 0.6 μl 1mM spike control 8-Br-2′,3′-cAMP (Biolog ...
-
bioRxiv - Microbiology 2022Quote: ... XTT (sodium 3′- [1- (phenylaminocarbonyl)- 3,4-tetrazolium]-bis (4- methoxy6-nitro) benzene sulfonic acid hydrate) (Sigma-Aldrich), according to the manufacturer’s recommended specifications ...
-
bioRxiv - Systems Biology 2020Quote: ... We changed medium 2 days later (Day -2) with addition of 3 μg/mL Doxycycline (Sigma D9891) to induce the NIL transcription factors ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 day old transgenic animals were anaesthetized on 2% agarose pads containing 2 mM levamisole (Sigma, L9756). DAF-28::GFP expression pattern was examined in at least 30 animals on day 3 of adulthood ...
-
bioRxiv - Cancer Biology 2021Quote: ... Membranes were blocked overnight at 4°C in 5% BSA (Sigma) then probed using pERK and tERK antibodies (Cell signalling ...
-
bioRxiv - Microbiology 2020Quote: ... Human mAbs were concentrated using Amicon Ultra-4 5 kDa (Millipore). Antibody concentration was determined by absorbance measurement at 280 nm using a Nanodrop and purity was determined using SDS-PAGE ...
-
bioRxiv - Systems Biology 2020Quote: 5’-(4-Fluorosulfonylbenzoyl) adenosine hydrochloride (FSBA) was obtained from Sigma-Aldrich. 1×107 DG75 cells were pelleted and lysed in NP40 buffer containing cOmplete ...
-
bioRxiv - Biochemistry 2020Quote: ... SUPELCOSIL LC18 (30 cm x 4 mm, 5 μm, Sigma-Aldrich), or an Eclipse XDB-C18 column (150 mm x 4.6 mm ...
-
bioRxiv - Molecular Biology 2021Quote: ... pombe cells were labeled with 5 mM 4-Thiouracil (Sigma-Aldrich) for 5 min ...
-
bioRxiv - Immunology 2020Quote: ... and 5 ng/ml of mouse recombinant IL-4 (Sigma-Aldrich) for CSR to IgG1 ...
-
bioRxiv - Immunology 2024Quote: ... and 5 ng/ml of mouse recombinant IL-4 (Sigma-Aldrich) (L-I) ...
-
bioRxiv - Genomics 2023Quote: ... pombe cells were labeled with 5 mM 4-thiouracil (Sigma-Aldrich) for 5 min ...
-
bioRxiv - Cell Biology 2024Quote: ... carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (FCCP; 5 µM, SML2959, Sigma-Aldrich), and Rotenone (1 µM ...
-
bioRxiv - Biophysics 2023Quote: ... different amounts of freeze dried GelMA macromer were dissolved in DPBS containing 0.5% (w/v) 2-Hydroxy-4’-(2-hydroxyethoxy)-2- methylpropiophenone (Sigma-Aldrich) as photoinitiator ...
-
bioRxiv - Neuroscience 2024Quote: ... containing 200 µM Tris [(1-benzyl-1H-1,2,3-triazol-4- yl)methyl]amine (TBTA; Sigma Aldrich, 678937-50MG), 500 µM Tris(2-carboxyethyl)phosphine hydrochloride (TCEP ...
-
bioRxiv - Biochemistry 2022Quote: ... were mixed with a stock solution of 40% positively charged (3-acrylamidopropyl)-trimethylammonium chloride (75% wt, Aldrich) or negatively charged 2-acrylamido-2-methyl-1-propanesulfonic acid (AMPS, Sigma-Aldrich, Inc) containing N,N’-methylenebisacrylamide (Sigma ...
-
Naked Mole-Rat Hematopoietic Stem and Progenitors are Highly Quiescent with an Inherent Myeloid BiasbioRxiv - Cell Biology 2021Quote: Mice aged 6 months or naked mole-rats aged 2-4 years were intraperitoneally (i.p.) injected with 1mg (2′S)-2′-Deoxy-2′-fluoro-5-ethynyluridine (F-ara-EdU; Sigma) from a 10mg/ml stock in DMSO diluted with sterile 0.9% sodium chloride solution (Sigma).
-
bioRxiv - Immunology 2022Quote: ... 200 μg/ml of the antioxidant 2,6-di-tert-butyl-4-methylphenol (BHT; Sigma-Aldrich), and 3 μl of SPLASH LIPIDOMIX Mass Spec Standard (#330707 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 200 μg/ml of the antioxidant 2,6-di-tert-butyl-4-methylphenol (BHT; Sigma Aldrich), 3 μl of UltimateSPLASH™ ONE internal standard mix (#330820 ...
-
bioRxiv - Cell Biology 2023Quote: ... 200 μg/ml of the antioxidant 2,6-di-tert-butyl-4-methylphenol (BHT; Sigma Aldrich), 3 μl of SPLASH® LIPIDOMIX® Mass Spec Standard (#330707 ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 μg/ml of the antioxidant 2,6-di-tert-butyl-4-methylphenol (BHT; Sigma Aldrich) solution were added ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were centrifuged 1800 rpm for 6 minutes at 4°C and pellets were resuspended n 3 mL RBC lysis for 4 minutes (Sigma). Samples were centrifuged 1800 rpm for 6 minutes at 4°C and the pellets were resuspended in 200 μl of PBS + 2% FBS + 2 mM EDTA ...