Labshake search
Citations for Millipore Sigma :
1001 - 1050 of 10000+ citations for 7 Chlorothieno 2 3 c pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... embedded into 7% agarose (Sigma Aldrich A0701) and cut into through vibratome (VT 1000S ...
-
bioRxiv - Microbiology 2024Quote: ... Polyethyleneimine (PEI) solution (Sigma Aldrich 40872-7) was added to give a final PEI concentration of 0.1 mg/mL (Nian et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... 7′-dichlorofluorescein diacetate (DCF-DA; Sigma-Aldrich). DCF-DA undergoes oxidation to form fluorescent DCF (2′ ...
-
bioRxiv - Plant Biology 2023Quote: ... the segment was incubated with the enzyme Driselase for 72 hours at 22°C-37°C (based on [18]) (Sigma-Aldrich, Missouri, USA; 2% (wt) Driselase solved in phosphate-buffered saline) ...
-
bioRxiv - Cell Biology 2022Quote: ... MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) was used for cell viability (Sigma, Israel).
-
bioRxiv - Biophysics 2021Quote: ... The bottom coverslip was functionalized with an amino-group in the 2% 3-aminopropyltheithoxysilane (440140, Sigma) in acetone for 10 min ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Neuroscience 2021Quote: ... Amigo2-icreER;ROSA-TdTomato mice were given 2 or 3 daily intraperitoneal injections of tamoxifen (Sigma T5648 ...
-
bioRxiv - Neuroscience 2019Quote: ... embedded with sucrose 30% for 3 days and finally frozen in 2-methylbutane (Sigma-Aldrich, France) at −80°C ...
-
bioRxiv - Cell Biology 2021Quote: ... and washed 3 times in 1x PBS and 2 times in 2x SSC buffer (Sigma-Aldrich) for five min each ...
-
bioRxiv - Neuroscience 2021Quote: ... frozen VMH (from 2 – 3 mice) was homogenized in Lysis Buffer (EZ Prep Nuclei Kit, Sigma) with Protector RNAase Inhibitor (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell viability was evaluated by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma) assay as described previously(Lv et al ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cells were next incubated with 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (Sigma-Aldrich M5655) for 4h followed by formazan crystal solubilization with isopropanol and absorbance readings at OD570 (Kumar et al. ...
-
bioRxiv - Immunology 2020Quote: ... 2-3 × 105 cells/well were plated in an ELI Spot plate (MAHAS4510, Merck Millipore, USA) and in vitro cultured for 18-24 hours in media supplemented with or without peptide at 0.5 µM (or ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Cytotoxicity was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich) assays ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cell viability was evaluated by adding MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (Sigma) to the cells for 4 h and OD562 measurements according to the manufacturer’s protocols (Sigma).
-
bioRxiv - Bioengineering 2020Quote: ... and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) were purchased from Sigma-Aldrich. Glutaraldehyde (50% w/w ...
-
bioRxiv - Genetics 2019Quote: BzATP (2′(3′)-O-(4-Benzoylbenzoyl) adenosine 5′-triphosphate triethylammonium salt) was purchased from Millipore Sigma and ...
-
bioRxiv - Neuroscience 2020Quote: SNAP-5114 (1-[2-[tris(4-methoxyphenyl)methoxy]ethyl]-(S)-3-piperidinecarboxylic acid) from Sigma-Aldrich
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 10 mM Sodium butyrate supplemented with 25 μl Phosphatase Inhibitor Cocktail 2&3 (P5726&P0044, Sigma) and 1 tablet of proteinase inhibitor cocktail (A32963 ...
-
bioRxiv - Microbiology 2020Quote: ... phenylethanol and 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT) were obtained from Sigma-Aldrich.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and phosphatase inhibitor cocktails 2 and 3 were obtained from Sigma-Aldrich (St. Louis, MO, USA). The secondary fluorescent antibody Alexa Fluor 488 (goat anti-mouse ...
-
bioRxiv - Molecular Biology 2022Quote: The 3-(4,5-dimethylthiazol-2-ul)-2,5-diphenyl tetrasodium bromide (MTT, Sigma-Aldrich, St. Louis, MO) cytotoxicity assay measures mitochondrial reductases ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Neuroscience 2022Quote: ... Selection was initiated after 2-3 days with 25-150μg/ml of Hygromycin B (Sigma-Aldrich) and maintained for 10-15 days ...
-
bioRxiv - Molecular Biology 2023Quote: ... coverslips were incubated for 3 hours in 100 μl of 2% acrylamide (AA; A4058, Sigma-Aldrich) + 1.4% formaldehyde (FA ...
-
bioRxiv - Microbiology 2023Quote: ... and tissues digested in 3 mL complete HBSS-2 containing 0.5 mg/mL Collagenase-D (Sigma) at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... and 2-heptyl-3-hydroxy-4-quinolone (PQS) were obtained from Sigma Aldrich (St. Louis, MO). Triton X-100 and Tween-20 were used at 0.2% and 2% ...
-
bioRxiv - Cancer Biology 2023Quote: Cellular proliferation was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium (MTT; Sigma) assay and validated by viable cell counts.80
-
bioRxiv - Cancer Biology 2022Quote: ... cell viability was assessed using MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) (Sigma-Aldrich). 10μl MTT (5 mg/ml ...
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Bioengineering 2022Quote: ... USA) and subsequently submerged in a solution of 2% bis[3-(trimethoxysilyl)propyl]amine (Sigma-Aldrich), and 1% DI-water in IPA at 80°C for 20 minutes following previously published protocols 67 ...
-
bioRxiv - Bioengineering 2023Quote: ... MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium) reagent and paraformaldehyde were purchased from Sigma-Aldrich, USA ...
-
bioRxiv - Neuroscience 2023Quote: ... 0,005 CPP [()-3-(2-carboxypiperazin-4-yl)propyl-1-phosphonic acid] (NMDA receptors antagonist, Sigma Aldrich). Traces of whole-cell voltage-clamp recordings (holding potential ...
-
bioRxiv - Microbiology 2023Quote: ... LDH buffer contained: 3 µl of “INT” solution containing 2 mg/ml tetrazolium salt (Sigma I8377) in PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3-(4,5 dimethylthiazol-2-tl)-2,3-diphenyltetrazolium bromide (MTT) was purchased from Sigma-Aldrich (STL, USA). Bovine serum albumin (BSA ...
-
bioRxiv - Microbiology 2024Quote: ... 3-(2pyridyl)-5,6-bis(2-(5-furylsulfonic acid))-1,2,4-triazin (Sigma-Aldrich, St Louis, MO, USA) (27) ...
-
bioRxiv - Cancer Biology 2024Quote: ... LDH buffer contained: 3 µl of “INT” solution containing 2 mg/ml tetrazolium salt (Sigma I8377) in PBS ...
-
bioRxiv - Bioengineering 2024Quote: ... Phalloidin and MTT [3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were purchased from Sigma Aldrich. DMEM (Dulbecco’s Modified Eagle’s Medium) ...
-
bioRxiv - Bioengineering 2024Quote: ... supplemented with 0.5 mg/mL 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT, Sigma, USA) for 4 hrs at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and incubated for 30 min with 10 µM 6-chloromethyl-2’,7’-dichlorodihydrofluorescein diacetate (DCFDA) and 1mg/L Hoechst 33342 dye (Sigma Aldrich, United States) diluted in media ...
-
bioRxiv - Biophysics 2023Quote: Photodynamic effect of MB-loaded nanoMOFs and other formulations was measured using 2’,7’-dichlorofluorescin diacetate (H2DCF-DA) (Sigma-Aldrich, St Louis, MO), which converts upon ROS generation into fluorescent oxidation product ...
-
bioRxiv - Cancer Biology 2021Quote: ... 50,000 cells at ∼70% viability were spun down and incubated 3 min at 4°C in 25µl of a detergent buffer containing 0.2% Igepal CA-630 (Sigma, #I8896), 0.2% Tween 20 (Sigma ...
-
bioRxiv - Plant Biology 2019Quote: Treatments with the NO-scavenger 2-(4-Carboxyphenyl)-4,5-dihydro-4,4,5,5-tetramethyl-1H-imidazol-1-yloxy-3-oxide potassium salt (c-PTIO salt, Sigma Aldrich, Darmstadt, Germany) were performed 1 hour prior to ethylene treatments to allow for treatment combinations ...
-
bioRxiv - Immunology 2019Quote: ... Embryos were grown at 28.5°C and kept under anesthesia with egg water containing 0.02% buffered 3-aminobenzoic acid ethyl ester (Tricaine, Sigma) during bacterial injections ...
-
bioRxiv - Biochemistry 2021Quote: ... after a 60 min incubation at 25 °C the reactions were stopped by addition of 3 μl 3.3 × LDS sample buffer (Sigma) containing NEM (40 mM final concentration ...
-
bioRxiv - Biochemistry 2021Quote: ... The C-terminal domain (CTD) of DRH-3 (residues 940-1108) was cloned into the expression vector pET15b (Novagen), and the resulting clone carries an N-terminal His6 tag and a thrombin cleavage site ...
-
bioRxiv - Plant Biology 2020Quote: ... Trypsin digestion was stopped either by heating at 95 °C for 3 min or by ultrafiltration using 0.5 ml Amicon Ultra centrifugal devices (20 kDa MWCO, Millipore). A five microliters aliquot was kept for MALDI-TOF MS analysis and the rest was used for the enrichment of biotinylated peptides by affinity chromatography.
-
bioRxiv - Microbiology 2020Quote: ... The membrane was then incubated in blocking buffer for 1 hour at 25°C (TBST with 3% BSA; Sigma) before being probed for LapA or MapA containing an HA tag with an anti-HA antibody (Biolegend ...
-
bioRxiv - Molecular Biology 2021Quote: ... The unbroken cells were removed by centrifugation (3,000 x g; 4°C; 5 min; Sigma 3-16KL; rotor 11180). The membrane fraction was pelleted down by high-speed centrifugation (100,000 x g ...