Labshake search
Citations for Millipore Sigma :
9951 - 10000 of 10000+ citations for 6 METHOXY PYRIDINE 3 SULFONYL CHLORIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... The filtrate was centrifuged for 3 min at 300 x g and resuspended in 1 mL of 50 mg/mL BSA (Cat.No. A8806; Sigma-Aldrich) in phosphate buffered saline (PBS) ...
-
bioRxiv - Biochemistry 2021Quote: An RNA oligonucleotide (5′ -UUUUCAUGCUACGCGUAGUUUUCUACGCG-3′; 4N) with Cyanine 5.5 at the 5′-end was obtained from Millipore Sigma (USA). The RNA scaffold was annealed in 20 mM HEPES ...
-
bioRxiv - Immunology 2020Quote: ... Sorted cells were then spun (1000 xg for 5 minutes) onto glass slides using a Shandon Cytospin 3 Cytocentrifuge (ThermoScientific) and stained with Prussian Blue and Neutral Red (Sigma). Red pulp macrophages were visualised and photographed using a Leica DM1000 light microscope (100x oil objective).
-
bioRxiv - Developmental Biology 2020Quote: ... plates of 3 mL ASW+BSA were supplemented with 1:1000 dilution of U0126 stock solutions (Sigma Cat. #662005-1MG) dissolved in DMSO to produce the indicated concentrations of U0126 ...
-
bioRxiv - Developmental Biology 2021Quote: Primary polyps were incubated in freshly filtered (0.2 μm) seawater with 3 μM calcein blue (Sigma–Aldrich 54375-47-2) for 4-5 hours ...
-
bioRxiv - Developmental Biology 2021Quote: ... embryos were removed from the egg and anaesthetised in a petri dish of seawater containing 10mg/mL ethyl 3-aminobenzoate methanesulfonate salt (MS-222, Sigma) prior to microinjection according to Gillis and Hall (2016) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Eluted protein samples were combined in one tube and desalinated using an ultrafiltration tube (Amicon Ultra 3 kDa molecular weight cut-off, Merck/Millipore) with Buffer C (50 mM Tris-HCl (pH 7.5) ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were blocked for 1 hour in 3% BSA-TBS and incubated overnight at 4°C with the following primary antibodies: anti-phosphotyrosine 4G10 (Millipore), anti-phosphorylated SYK (pY525/526 ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were treated during the 3 days chase period with the following compounds: Bafilomycin A1 (5-10 nM; Sigma-Aldrich), Rab7 inhibitor (CID 1067700 ...
-
bioRxiv - Cell Biology 2020Quote: ... Embryos were then washed 3 x 5 min with 3% BSA in PBS-T and incubated with the following DNA dye and secondary antibody dilutions in blocking solution for 3 hours at room temperature: Hoechst 33342 (0.2 mM, Sigma-Aldrich), Goat Anti-Chicken Alexa Fluor® 647 (4 μg/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... were mixed in a 1:3 molar ratio and incubated overnight at room temperature with calf intestinal alkaline phosphatase (Sigma). After 12-18h ...
-
bioRxiv - Biophysics 2021Quote: ... DNA and RNA samples used for NMR measurements were buffer exchanged into the desired NMR buffer with final concentration ~1 mM using Amicon Ultra-0.5/15 centrifugal concentrators (3-kDa cutoff, Millipore Sigma). The samples used for optical melting experiments were prepared by diluting NMR samples to ~3 μM using buffer ...
-
bioRxiv - Immunology 2020Quote: ... 8-20 weeks after reconstitution chimeric mice were injected intraperitoneally for 3 d with 2 mg/day of tamoxifen (Sigma) re-suspended at 20 mg/ml in corn oil (Sigma ...
-
bioRxiv - Immunology 2020Quote: Each peptide sample was desalted on Empore SPE C18 cartridges (standard density, bed inner diameter 7 mm, volume 3 ml; Sigma), then concentrated by vacuum centrifugation and reconstituted in 40 µl 0.1% (v/v ...
-
bioRxiv - Microbiology 2020Quote: ... 5 days post fertilization (dpf) zebrafish larvae were anaesthetized with 0.017% Ethyl 3-aminobenzoate methanesulfonate (MS-222, Tricaine, Sigma-Aldrich) in egg water ...
-
bioRxiv - Microbiology 2020Quote: ... 10 mM EDTA) with 0.5 mg/mL lysozyme and 3 mg/mL proteinase K (Sigma-Aldrich Corp., St. Louis, MO). To obtain sufficient DNA from AR BANK # 0943 and AR BANK # 0958 ...
-
bioRxiv - Microbiology 2019Quote: ... Ambient air was injected in the system at a flowrate of 3 L/min using an aquarium air pump equipped with a 0.2 µm air filter (Millipore, USA). Prior to the start of the experiment ...
-
bioRxiv - Immunology 2021Quote: ... Slices were transferred to Millicell-CM membrane inserts (0.4 μm pore size, 30 mm diameter, 2-3 slices per insert; Millipore Corp) in six well tissue culture treated plates containing MEM with 25% horse serum and 6.5 mg/mL of glucose ...
-
bioRxiv - Immunology 2021Quote: ... or 2 μM NH-3 in the presence of 10 nM T3 for 24 h before the addition of 3 μL of a fluorescent latex bead suspension (L0280, Sigma) in complete DMEM in a ~100:1 bead-to-cell ratio for 2 h before the end of the experiment ...
-
bioRxiv - Microbiology 2021Quote: ... harvesting at 3 dpi) using DMEM supplemented with 2% FBS and 1 μg/mL TPCK-trypsin (Sigma-Aldrich #1426-100MG). SARS-CoV and MERS-CoV viral stocks were generated by infecting VeroE6 cells (MOI 0.0001 ...
-
bioRxiv - Microbiology 2020Quote: ... 198 μl/well were transferred into 3 wells of a black 96-well plate with transparent flat bottom (Sigma Aldrich). Then ...
-
bioRxiv - Molecular Biology 2021Quote: ... infected in BGM containing Adeno-GFP (1×1010) or Adeno-ADH5 (1×1012) and differentiated in BGM containing 0.25nM 3-Isobutyl-1-methylxanthine (IBMX, Sigma, I5879), 1uM Rosiglitazone (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... cells were washed with serum-free DMEM and cultured in DMEM containing 3% FBS and 1.5% sodium carboxymethyl cellulose (Sigma-Aldrich). Visible plaques were counted ...
-
bioRxiv - Microbiology 2021Quote: ... and human choriocarcinoma/trophoblastic cancer (JEG-3) cells were grown in DMEM supplemented with 10% FBS and MEM Non-essential Amino Acid Solution (Sigma). C6/36 cells were grown at 28°C in a 5% CO2 incubator ...
-
bioRxiv - Immunology 2021Quote: ... PBMCs were frozen at a concentration of 1-3×107 cells/ml in 10% DMSO (Sigma-Aldrich, St. Louis, MO)/90% FCS (Atlanta Biologicals ...
-
bioRxiv - Microbiology 2021Quote: ... RH TIR1-3FLAG or RH TgPDE-mAID-3HA tachyzoites cultivated in HFFs in D10 medium were treated with 0.5 mM 3-indoleacetic acid (auxin; IAA) (Sigma Aldrich) prepared in 100% ethanol (Pharmco ...
-
bioRxiv - Microbiology 2021Quote: ... 200 μL of lysis buffer (8M urea in 50mM Tris-Cl pH 7.5, supplemented with phosphatase inhibitor cocktail 3 [Millipore-Sigma]) was added to each of the pellets and pipetted up and down several time to lyse a portion of the pellet ...
-
bioRxiv - Immunology 2021Quote: ... and PBS-treated (n ≥ 3) control human gut xenografts and mouse jejunum were purified using GenElute Mammalian Total RNA kit (Sigma) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: Oligonucleotides containing the sequence 5’-TGCATGTTCTCACTGCTCCTTTACTAGCAAATACAACAGAAGACAAACCTAGTAA AGATGATTTTCAGACTGCCCAACTATTGGCACTTGTATTGGAATTGTTAACATTTT GTGTGGAGCACCATACCTACCACATAAAGAACTACATTATTAATAAGGATATCCT CCGGAGAGTGCTAGTTCTTATGGCCTCGAAGCATGCTTTCTTGGCATTATGTGCC CTTCGTTTTAAAAGAAAGATTATTGGATTAAAAGATGAGTTTTACAACCGCTACA TAATGAAAAGTTTTTTGTTTGAACCAGTAGTGAAAGCATTTCTCAACAATGGATC CCGCTACAATCTGATGAACTCTGCCATAATAGAGATGTTTGAATTTATTAGAGTG GAAGATATAAAATCATTAACTGCTCATGTAATTGAAAATTACTGGAAAGCACTG GAAGATG-3’ were used (Mission esiRNA, Sigma) and transfected into cells using Lipofectamine 2000 reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... This formulation lacked Wnt3a and R-spondin-3 but was supplemented with EGF (50 ng/mL) along with Gastrin (10 nM, Sigma), Noggin (50 ng/mL ...
-
bioRxiv - Genetics 2019Quote: ... The infectious blood meal was composed of a virus suspension diluted (1:3) in washed rabbit blood and resuspended at 50% (vol/vol) in dialyzed rabbit serum (R4505; Sigma). ATP was added to a final concentration of 5 μM ...
-
bioRxiv - Genomics 2021Quote: ... then permeabilized and blocked for non-specific binding in blocking buffer containing 3% normal horse serum and 0.25% Triton X-100 (Sigma X100) in a humidified chamber for 1 hr at room temperature8 ...
-
bioRxiv - Genomics 2021Quote: Sections were washed in 0.1M TBS and then non-specific binding site blocking and cell permeabilization was performed with blocking buffer containing 3% normal horse serum and 0.25% Triton X-100 (Sigma X100). Sections were incubated with primary antibody (see list below ...
-
bioRxiv - Genomics 2021Quote: Fresh nuclei were incubated for 3 minutes at 37°C with limiting concentrations of the DNA endonuclease deoxyribonuclease I (DNase I) (Sigma) in buffer A supplemented with Ca2+ ...
-
bioRxiv - Cell Biology 2021Quote: ... fresh-frozen tissue sections were fixed in 4% paraformaldehyde in HBSS overnight at 4°C and treated with 0.2 N HCl for 20 minutes and subsequently with 3 μg/ml Proteinase K (#3115887001, Sigma-Aldrich) for 7 minutes at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: Confluent ESCs monolayers were decidualized in DMEM/F12 containing 2 % FBS supplemented with 0.3 mM N6,2′-O-Dibutyryladenosine 3′,5′-cyclic monophosphate sodium salt (cAMP) (Sigma-Aldrich, USA), 10 nM β-Estradiol (E2 ...
-
bioRxiv - Immunology 2021Quote: ... were pelleted at 3.000g for 3 minutes and induced by resuspension in YNB-CAA + 2% D-(+)-Galactose (Sigma G0625-500G) + phosphate buffer + P/S induction medium at a final OD600 of 0.5 ...
-
bioRxiv - Genetics 2021Quote: ... The plasmids for inducible expression of the human CNBP counterpart was generated by cloning the FLAG epitope CDS fused in-frame with the 3′ end of the hCNBP CDS (CNBP-201 splice variant, CCDS 3056.1) into the UAS-attB vector (Genewiz, SIGMA-ALDRICH). The dCNBP-3HA-res or UAS-hCNBP-FLAG were injected in y1 w67c23 ...
-
bioRxiv - Cell Biology 2021Quote: ... sphere (1.5 μm – 3 μm)) coated with 8.45 mM poly(ethylene glycol)methyl ether thiol (Mn 800, Cat. No. 729108, Sigma Aldrich) solution for 2 h at room temperature were used ...
-
bioRxiv - Microbiology 2022Quote: ... and the ampicillin media was stained by adding 5 µl and 3 µl of a fluorescent dye (rhodamine, Sigma S1402) in 100ml of media used to grow MG:GT and MG/pBGT cells ...
-
bioRxiv - Neuroscience 2022Quote: ... permeabilization and blocking of non-specific binding with 0.2 % Triton-X and 3 % bovine serum albumin (BSA, A7906, Sigma Aldrich), samples were incubated overnight at 4 °C with a solution of PBS containing 0.2 % Triton-X ...
-
bioRxiv - Neuroscience 2022Quote: Larvae were anesthetized in 0.2 mg/mL ethyl-3-aminobenzoic acid ethyl ester (MESAB, Sigma-Aldrich E10521, St. Louis, MO) prior to imaging except where noted ...
-
bioRxiv - Cell Biology 2022Quote: ... and transferred to 1.5 ml Eppendorf tubes where the cells were fixed for a minimum of one hour or overnight in 3% formaldehyde (Sigma) in PBS ...
-
bioRxiv - Biochemistry 2022Quote: ... Labelled XIAP BIR2AG124-240 was directly concentrated on 3 KDa molecular weight cut off Centricon centrifugal filter units (EMD Millipore) until 300 μL at 240 μM were obtained.
-
bioRxiv - Biophysics 2022Quote: ... The UBF solution was supplemented with 10% glycerol and concentrated in Amicon Ultra 3 MWCO (molecular weight cut-off) concentrator columns (Millipore-Sigma UFC 500396 - hereafter called Amicon concentrators) ...
-
bioRxiv - Biophysics 2022Quote: ... The UBF solution was supplemented with 10% glycerol and concentrated in Amicon Ultra 3 MWCO (molecular weight cut-off) concentrator columns (Millipore-Sigma UFC 500396 - hereafter called Amicon concentrators) ...
-
bioRxiv - Cell Biology 2022Quote: ... washed in ice-cold PBS and lysed in room temperature NP40 lysis buffer (50 mM Tris pH 7.4, 140 mM NaCl, 3 Na3VO4, 1% v/v IGEPAL CA-360 (Sigma, #I8896), Phosphatase Inhibitor cocktail (PhosStop ...
-
bioRxiv - Cell Biology 2022Quote: ... The selected elution fractions (1-3 of 500 μL each) were pooled and subsequently concentrated using 100-kDa Amicon centrifugal filter units (Merck Millipore). The concentrated samples were subjected to several washing steps with PBS to obtain a highly pure EV population ...
-
bioRxiv - Bioengineering 2022Quote: ... a 6 well plate was seeded with HEK293Ta cells at a seeding density of 3×105 cells in DMEM supplemented with 8mg/ml Polybrene (Sigma). Each well was then transduced with either 5μl ...
-
bioRxiv - Biochemistry 2022Quote: ... Blots were washed an additional three time with TBS-T and one time with TBS before 3 minute exposure with ECL HRP substrate (Millipore) and imaged on a BioRad ChemiDoc system ...