Labshake search
Citations for Millipore Sigma :
51 - 100 of 1510 citations for MERS Coronavirus Spike Glycoprotein S1 Camel Fc Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... HEK293 cells (Sigma Aldrich 12022001-1VL) were maintained in DMEM supplemented with L-glutamine and 10% FBS ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and 1 mg/ml AAG (human a1-acid glycoprotein, Sigma, Cat # G9885). All medium is sterilized by filtration through a 0.22mm membrane ...
-
bioRxiv - Biochemistry 2022Quote: ... or 100nM of synthetic RNA [45-mer: 5′ GGGUCAACGUGGGCAAAGAUGUCCUAGCAAGCCAGAAUUCGGCAG −3′] generated by Sigma. In reactions where CifA was co-present with CifB ...
-
bioRxiv - Biochemistry 2023Quote: ... The respective 97-mer oligonucleotides (Sigma Aldrich, for guide sequences see table 2) were amplified by PCR using the following conditions ...
-
bioRxiv - Biochemistry 2023Quote: ... His tag and Flag tag (1:1000; F3165, Sigma).
-
bioRxiv - Microbiology 2023Quote: ... strep tag and myc tag were obtained from Sigma, IBA and Abcam ...
-
bioRxiv - Microbiology 2022Quote: ... Coronavirus OC43 (ATCC VR-1558) was propagated in HCT-8 cells and detected by antibody staining (MAB9012, Millipore).
-
bioRxiv - Cancer Biology 2022Quote: Expression of indicated Flag-tagged CDK6 constructs in HEK293 cells were determined via Western blotting with indicated Flag antibody [mouse anti-FLAG® M2-tag (Sigma-Aldrich, St. Louis, MO, USA, F3165-1MG)] ...
-
bioRxiv - Microbiology 2020Quote: ... Anti-ICP4 MAb H1A021 or monoclonal Ab to VSV glycoprotein G (P5D4, Sigma) was added for 1 h followed by Alexa Fluor 488-labeled goat anti-mouse IgG (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... Then 1 µg/well of biotinylated α1-acid glycoprotein (Sigma, Catalogue number-112150) or 3’-sialyllactose-PAA-biotinylated (Glycotech ...
-
bioRxiv - Biochemistry 2020Quote: ... FLAG tag (F1804) or His tag (H1029) were from Sigma. Mouse monoclonal antibody raised against hemagglutinin (HA ...
-
bioRxiv - Immunology 2020Quote: ... FCS (Sigma Life Science ...
-
bioRxiv - Biochemistry 2019Quote: ... 1 μM of mRNA oligomer (MF, aMF, or random 24-mer; Sigma Aldrich Corporation), and 250 nM of Sa-RelQ/Sa-RelP/EF-RelQ protein (calculated as a tetramer) ...
-
bioRxiv - Biochemistry 2022Quote: Human embryonic kidney 293 cells (HEK293) (Sigma), HEK293T (TakaraBio) ...
-
bioRxiv - Biophysics 2021Quote: HEK293 cells were cultured in DMEM (Sigma) containing 10% FBS (Life Technologies) ...
-
bioRxiv - Cell Biology 2019Quote: HEK293 cells were cultured in DMEM (Sigma) with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Genomics 2022Quote: ... HEK293 cells were passaged in DMEM (Sigma) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... Flag-tag (Sigma), Myc-tag (Upstate) ...
-
bioRxiv - Microbiology 2022Quote: ... Mouse monoclonal antibody MAB8150 against WNV E glycoprotein was from EMD Millipore (Billenca MA). Alexa Fluor 488 goat anti-mouse IgG (H+L ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-spike (Cat#ZMS1076, Sigma Aldrich), mouse anti-Strep (Qiagen ...
-
bioRxiv - Biochemistry 2021Quote: ... The MERS-CoV peptide was labeled with sub-stoichiometric FITC (Sigma-Aldrich, St. Louis, Missouri) in a basic HEPES buffer (pH 8.2 ...
-
bioRxiv - Biochemistry 2021Quote: ... The 3’ biotinylated TAR and RNA 30-mer (Table 1) were chemically synthesized (Sigma Aldrich). RNA (50 pmol ...
-
bioRxiv - Neuroscience 2020Quote: Human Embryonic Kidney Cells (HEK293) and HEK293 Flp-In T-Rex cells were grown and maintained in Dulbecco’s modified Eagle medium (DMEM, Sigma-Aldrich) supplemented with 10% (v/v ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 FlpIn mycBirA*FOPNL and HEK293 FlpIn mycBirA* cells were incubated for 24 h with 50 μM biotin (Sigma-Aldrich) in the presence or absence of 0.1 μg/ml tetracycline.
-
bioRxiv - Microbiology 2021Quote: ... except that the primary antibody for viral detection was a monoclonal antibody against the coronavirus group antigen (Milipore Sigma #MAB9013) and the secondary was a horseradish-peroxidase-conjugated goat-anti-mouse antibody (enQuire BioReagents # Q2AB1).
-
bioRxiv - Immunology 2022Quote: ... Percentage of infected cells were measured by intracellular staining for the nucleoprotein (mouse anti-coronavirus OC43 nucleoprotein clone 542-70, Millipore).
-
bioRxiv - Immunology 2019Quote: ... and HEK293 and HEK293T cells in DMEM (Sigma) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... and HEK293 cells with polyethylenimine (PEI, Sigma Aldrich). Details are described in the SI Appendix ...
-
bioRxiv - Neuroscience 2022Quote: HEK293 culture (ECACC 85120602, Sigma-Aldrich, Munich, Germany), transfection and electrophysiological recordings were performed as described previously (Grimm et al. ...
-
bioRxiv - Biophysics 2023Quote: HEK293 cells were cultured in RPMI medium (Sigma) supplemented with 10% v/v fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293 cells were treated with MG132 (Sigma-Aldrich) at a final concentration of 1 or 10 µM ...
-
bioRxiv - Bioengineering 2021Quote: ... were coated with 100 μl (5 μg/ml) of purified S1 or S1-RBD or commercial human serum albumin (HSA; Sigma-Aldrich) and incubated overnight at 4°C ...
-
bioRxiv - Genetics 2019Quote: ... 10% FCS (Sigma) supplemented with FLT3L (50 ng/ml) ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 % FCS (Sigma) and P/S (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... + 10% FCS (Sigma,) + 1 x (final concentration ...
-
bioRxiv - Cell Biology 2021Quote: ... 10% FCS (Sigma), 2 mM L-glutamine ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 % FCS (Sigma) in DPBS for 1 h ...
-
bioRxiv - Cell Biology 2023Quote: ... 10% FCS (Sigma), NEAA ...
-
bioRxiv - Cell Biology 2021Quote: ... FLAG-tag (Sigma F3165), Actin (Sigma A2066) ...
-
bioRxiv - Cell Biology 2021Quote: ... Flag-tag (M2, Sigma), TOP2A (M042-3 ...
-
bioRxiv - Neuroscience 2021Quote: ... FLAG-tag (Sigma F3165), Tubulin (Sigma T6557) ...
-
bioRxiv - Neuroscience 2020Quote: ... double immunohistochemistry was performed using primary antibodies for myelin/oligodendrocyte glycoprotein (MOG, Sigma-Aldrich, SAB1406138) and neurofilament (NF ...
-
bioRxiv - Cell Biology 2019Quote: ... Blocking was performed with a 1% solution of glycoprotein free Bovine Serum Albumin (Sigma - A3059) in PBS for 1 h at room temperature ...
-
bioRxiv - Immunology 2022Quote: 10ug recombinant LCMV glycoprotein in PBS was diluted 1:1 in Sigma Adjuvant System (Sigma) and administered i.p ...
-
bioRxiv - Microbiology 2021Quote: Six-week-old Balb/cN mice were primed subcutaneously either with 30 μg of recombinant SARS-Cov-2 Spike protein (S) or Spike-RBD (RBD) in the complete Freund’s adjuvant (SIGMA-ALDRICH) and boosted three times at three-week intervals with 20 μg of the same antigen in the incomplete Freund`s adjuvant ...
-
bioRxiv - Developmental Biology 2020Quote: ... containing 18.4 U nuclease S1 (Aspergillus oryzae, Sigma-Aldrich), 5 U Antarctic phosphatase (New England BioLabs ...
-
bioRxiv - Molecular Biology 2020Quote: 5′-biotinylated (RNA or DNA) oligonucleotides (Sigma, Table S1) were diluted with non-biotinylated complementary oligonucleotides in PBS ...
-
bioRxiv - Developmental Biology 2023Quote: ... and KiCqStart SYBR green primers (Sigma Merck, Table S1). Obtained Ct values were used for relative quantification of mRNA expression using the ddCt method ...
-
bioRxiv - Biophysics 2023Quote: ... The first solvent was pure DMSO (S1) (Sigma, ≥ 99.9%), the second solvent (S2 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Panc1 and HEK293 in DMEM (Sigma, Cat No. D1145), SH-SY5Y in 1:1 mixture of DMEM/F12 (Gibco ...