Labshake search
Citations for Millipore Sigma :
51 - 100 of 10000+ citations for Estrone 3 Glucuronide E1G ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Vitamin D signaling orchestrates skeletal muscle metabolic flexibility by regulating its fuel choicebioRxiv - Physiology 2023Quote: ... Serum insulin levels were determined by ELISA using mouse insulin ELISA kit from Sigma according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... siZWINT (Sigma, 5’-GCACGUAGAGGCCAUCAAA-3’). RNAiMAX (Invitrogen ...
-
bioRxiv - Plant Biology 2022Quote: ... The quantification of GUS staining was done using 4-methylumbelliferyl ß-D-glucuronide (4-MUG; Sigma) as a substrate with excitation at 365 nm and emission at 455 nm read using a plate reader POLARstar Omega (BMG Labtech ...
-
bioRxiv - Microbiology 2019Quote: ... Gal-3 levels were measured using commercially available enzyme-linked immunosorbent assay (ELISA) kits (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2024Quote: ELISAs were used to confirm a subset of cytokines identified in the antibody arrays (CCL2, CX3CL1, and Galectin-3 rat ELISA kits, Sigma) using apical or basal supernatants from individual Transwell® inserts from the same experiment than the multiplex array.
-
bioRxiv - Biochemistry 2022Quote: ... Cytidine 3′, 5′ cyclic monophosphate (3′, 5′ cCMP) and Cytidine 2′, 3′ cyclic monophosphate (2′, 3′ cCMP) were purchased from Sigma-Aldrich (Bangalore, India) and used without further purification ...
-
bioRxiv - Molecular Biology 2022Quote: ... Oligonucleotides 5’-GAAAAAAAAAATATACGCTAAGATTTTTGG-3’ and 5’-ATGACTAAACCCCCCCTCC-3’ synthesized and HPLC-purified by Sigma-Aldrich were used ...
-
bioRxiv - Physiology 2023Quote: ... CDH1 Forward 5′-TTACTGCCCCCAGAGGATGA-3′ and Reverse 5′- TGCAACGTCGTTACGAGTCA-3′;) were purchased from Sigma-Aldrich. mRNA expression was determined using the comparative 2-ΔΔCt method and normalized to the mRNA expression level of endogenous reference (PPIA ...
-
bioRxiv - Physiology 2023Quote: ... GLP-1 content in the supernatant of T0 and T20 samples was assessed using a Glucagon-Like Peptide-1 (GLP-1) Total ELISA KIT (96-Well Plate Cat. # EZGLP1T-36K, EZGLP1T-36BK, Millipore).
-
bioRxiv - Immunology 2022Quote: ELISA plates were coated overnight with anti-human IgG (Sigma Aldrich I5260) at 1:5 000 in PBS ...
-
bioRxiv - Physiology 2020Quote: ... and each circulating hormones were determined using a commercially available ELISA kit for total ghrelin (Rat/Mouse Total Ghrelin ELISA kit, EZRGRT-91K, Millipore), and active ghrelin (Rat/Mouse Total Ghrelin ELISA kit ...
-
bioRxiv - Plant Biology 2019Quote: ... 0.1 % Triton X-100 and 1 mM 4-methylumbelliferyl-β-D-glucuronide (4-MUG; 69602, Sigma-Aldrich) at 37°C for 90 min ...
-
bioRxiv - Biochemistry 2020Quote: ... Conduritol-β-epoxide and 4-methylumbelliferyl-β-D-glucuronide were from Sigma-Aldrich (St. Louis, MO, USA). Deuterated internal standard lipids phosphatidylcholine (PC 15:0/18:1-d7) ...
-
bioRxiv - Bioengineering 2020Quote: ... human VEGF ELISA kit (RAB0507-1KT, Sigma Aldrich), glutaraldehyde solution (340855 ...
-
bioRxiv - Cell Biology 2021Quote: ... ALP activity was determined by ELISA kit (Sigma) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... mouse FGF21 ELISA kit (Sigma-Aldrich, EZRMFGF21-26K).
-
bioRxiv - Neuroscience 2023Quote: ... anti-mouse IL-6 ELISA kit (Sigma, RAB0309), anti-mouse G-CSF ELISA kit (MCS00 ...
-
bioRxiv - Immunology 2022Quote: ... Cultures were stimulated with 20 ng/ml PMA for 3 hours and assessed with a mouse IFN-γ ELISA kit (Sigma-Millipore). For airway epithelial cell culture ...
-
bioRxiv - Neuroscience 2021Quote: Alongside the ELISA a Bicinchoninic acid assay (BCA) assay (#71285-3, Novagen, Millipore) was performed according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: Alongside the ELISA a Bicinchoninic acid assay (BCA) assay (#71285-3, Novagen, Millipore) was performed according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl benzonase (Millipore, 71206-3) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’, Sigma Aldrich). The siRNA for luciferase (siLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’, Sigma Aldrich), siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8A (5’-GACAAGUUUCCAAGGAACGtt-3’, Sigma Aldrich), siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’, Sigma Aldrich), siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’) (Sigma). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... with 3 mg 5-fluorouracil (Sigma). Bone marrow was collected after 4 days and cultured in DMEM containing 15% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mM 3-MA (Sigma) were added during the 16-h incubation period ...
-
bioRxiv - Cell Biology 2023Quote: ... siSpindly (Sigma-Aldrich, 5′-GAAAGGGUCUCAAACUGAA-3′) for 48 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... siTTLL12_6: 5’- GGUUGUUCGUGUAUGAUGU-3’ (Sigma-Proligo).
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...
-
bioRxiv - Physiology 2020Quote: ... according to the manufacturer’s instructions (Mouse Leptin ELISA Kit, 90030; Crystal Chem, Zaandam, Netherlands; Rat/Mouse Insulin ELISA Kit, cat. EZRMI-13K; Merck Millipore). The intra- and interassay coefficients of variation (CVs ...
-
bioRxiv - Pathology 2023Quote: ... adiponectin levels were measured by enzyme-linked immunosorbent assays (Human Chemerin ELISA kit, Biovendor, Brno, Czech Republic; Human Resistin ELISA kit, Millipore Sigma; Human Total Adiponectin/Acrp30 Quantikine ELISA Kit ...
-
bioRxiv - Biochemistry 2023Quote: Two complementary single strand oligonucleotides (5’-GTAATCTGGGCCACCTGCCTGGGAGGA-3’ and 5’-TCCTCCCAGGCAGGTGGCCCAGATTAC-3’) corresponding E2 box44 were Two complementary single strand oligonucleotides (5’-purchased from Sigma-Aldrich. An equal molar ratio of single strand oligonucleotides was mixed and incubated at 95°C for 5 min ...
-
bioRxiv - Immunology 2021Quote: ... ELISA plates were coated with the capturing reagent in PBS [OVA (Sigma, A5503) for antigen ELISAs ...
-
bioRxiv - Microbiology 2023Quote: Costar 96-well ELISA plates were coated with 10 μg of fibronectin (Sigma) for the fibronectin-binding assay and 10 μg of fibrinogen (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... 96-well ELISA plates were first coated overnight with poly-L-lysine (Sigma), then overnight with DNA from calf thymus (Sigma ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Signals (ΔCt) were normalized to GAPDH expression (GAPDHfw70 5’-CCACCCATGGCAAATCC-3’ and GAPDHrev70 5’-GATGGGATTTGCATTGATGACA-3’; Sigma). The amplification efficiencies were determined by serial dilution and calculated as E = 10-1/m × 100 ...
-
bioRxiv - Immunology 2022Quote: ... Cultures were stimulated with 20 ng/ml PMA for 3 hours and assessed with a mouse IFN-γ ELISA kit (Sigma-Millipore). For airway epithelial cell culture ...
-
bioRxiv - Physiology 2021Quote: We used ELISA kits to detect the concentrations of inflammatory mediators such as TNF-α (KIT ELISA TNF-a-RAB0477-1KT, Sigma-Aldrich) and IL-6 (KIT ELISA IL-6-RAB0308-1KT ...
-
bioRxiv - Molecular Biology 2021Quote: ... The levels of Aβ40 and Aβ42 were quantified by sandwich ELISA using Aβ40 and Aβ42 EZbrain ELISA kit (EMD Millipore) following the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2023Quote: FGF21 ELISA was performed following the manufacturer’s guidelines (FGF21 ELISA kit, Millipore Sigma catalogue number-EZRMFGF21-26K).
-
bioRxiv - Physiology 2022Quote: ... total adiponectin by ELISA kit EZMADP-60K (EMD Millipore), high molecular weight (HMW ...
-
bioRxiv - Physiology 2020Quote: ... Insulin was measured in plasma by ELISA kit (Millipore). For IP-GTT (2 g/kg ...
-
bioRxiv - Biochemistry 2023Quote: ... previously quantified via a human ANGPTL4 ELISA kit (Sigma).
-
bioRxiv - Cell Biology 2023Quote: ... The Anti-human IGFBP2 ELISA kit (Sigma, #RAB0233-1KT) was used to quantify IGFBP2 protein in the supernatants according to the manufacturer’s recommendations ...