Labshake search
Citations for Millipore Sigma :
351 - 400 of 10000+ citations for Estrone 3 Glucuronide E1G ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Cell toxicity was measured in 96-well plates (∼5×104 cells/well) using a lactate dehydrogenase (LDH) cytotoxicity kit (Sigma-Aldrich, Cat # 11644793001). Absorbance was measured at λ=490 nm ...
-
bioRxiv - Physiology 2023Quote: ... were transferred to OP50-seeded plates or RNAi-seeded NGM plates supplemented with 50 μM of 5-fluoro-2-deoxyuridine (FUDR, Sigma) to prevent progeny growth ...
-
bioRxiv - Immunology 2024Quote: ... MASP-3 and MAP-1 was measured in an ELISA assay where 10 µg/ml recombinant human albumin (rHA) (Sigma-Aldrich, A9731) was coated on Nunc MaxiSorp flat-bottom 96-well plates (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: ... all coverslips were incubated with a 5% 3-aminopropyltrimethoxysilane solution (281778, Sigma-Aldrich) in water for 30 minutes ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3-5 colonies were picked and incubated in 2mL Terrific Broth (T0918, Sigma) containing 100µg/mL Ampicillin for 8 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate-toluoidine were from Sigma-Aldrich, St ...
-
bioRxiv - Neuroscience 2020Quote: ... TodoNeo1: 5’–CCG CTT TTC TGG ATT CAT CGA C–3’from SIGMA life science) ...
-
bioRxiv - Microbiology 2019Quote: ... for 5 min at 14,000 rpm at 4°C (Sigma 3-KIS centrifuge). Samples were snap-frozen in liquid N2 and delipidated by protein precipitation based on the protocol of Wessel and Flügge (61) ...
-
bioRxiv - Cancer Biology 2021Quote: ... or 3-(1,3-Benzodioxol-5-ylmethylene)-2-oxo-1-pyrrolidinecarboxaldehyde (KNK437, Sigma Aldrich) for 24 hours prior to collection of cells for RNA extraction.
-
bioRxiv - Biochemistry 2022Quote: ... or 100nM of synthetic RNA [45-mer: 5′ GGGUCAACGUGGGCAAAGAUGUCCUAGCAAGCCAGAAUUCGGCAG −3′] generated by Sigma. In reactions where CifA was co-present with CifB ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1µl of each primer (10µm, 5’: FAATGGCAGAGTGGGGTTGGG, 3’: CGGCAAACGGACAGAAGCATT, Sigma-Aldrich, USA).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Membranes were washed 3×5 min with 0.1% Tween® 20 (Sigma-Aldrich) in TBS before a 1 hour incubation with a 1:5,000 dilution of sheep anti-mouse IgG horseradish perodixase secondary antibody (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... The probe used was as follows: 5’[6FAM]AGACTAATTCTCCTCGGCGGGCACG[TAM]3’ (Sigma Aldrich). Analysis was performed using the Rotor-Gene 6000 Series Software 1.7 (Corbett Life Sciences ...
-
bioRxiv - Immunology 2021Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (Sigma-Aldrich). Air-dried plates were read ...
-
bioRxiv - Neuroscience 2022Quote: ... and laminin for 3 hours at 37°C (5 μg/mL, Sigma L2020). To create single cell suspensions for plating aNSCs ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 dpf larvae were exposed to 3 μM CuSO4 (Sigma-Aldrich, Cat# 451677) diluted in EM in cell strainers (Corning ...
-
bioRxiv - Neuroscience 2022Quote: ... incubated in blocking solution (3% skimmed milk or 5% BSA (Sigma-Aldrich, A9647) in TBS + 0.01% Tween20 (Sigma ...
-
bioRxiv - Pathology 2023Quote: ... washed in TBS (3 × 5 min) and blocked in 1% BSA (Sigma Aldrich) in TBST (0.1% Tween-20 in TBS) ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM 8-bromoadenosine 3′,5′ cyclic monophosphate sodium salt (Sigma-Aldrich; “C”), and 0.1 mM 3-isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-(4,5-dimethylthiazol-2-Yl)-Diphenyltetrazolium Bromide (MTT, CT01-5, Sigma-Aldrich, UK) stock solution was diluted in F12 medium without phenol red (1:5) ...
-
bioRxiv - Genetics 2023Quote: ... beads were washed 3 times 5 minutes with lysis buffer (Sigma-Aldrich, L3412) on a rotator and protease and phosphatase inhibitors ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cordycepin was added to the 3’ end of in vitro transcribed mRNA by substituting 50 mM Cordycepin (3’-deoxyadenosine) 5’-triphosphate sodium salt (Sigma-Aldrich) in 10 mM Tris pH7 for ATP in a poly(A)-tailing reaction with a Poly(A ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 x 10 min 100% EtOH) and cleared (3 x 5 min) in xylene (247642, CAS: 1330-20-7, Sigma Aldrich). Finally ...
-
bioRxiv - Neuroscience 2023Quote: ... a shRNA sequence based on 5’-GCCTAAATGGTCAAGGAGATA-3’ as the sense nucleotide corresponding to the 3’UTR of mouse mDia1 (NM_007858.4; Sigma-Aldrich, Cat# TRCN0000108685) was designed as an oligonucleotide with overhangs (s ...
-
bioRxiv - Genomics 2023Quote: ... then quickly was cut to small pieces (1-3 mm) in petri dish with 3 -5 ml RMPI medium containing 0.05mg/ml TM Liberase (Sigma Aldrich, 5401119001) and 0.02 mg/ml DNAaseI (ThermoFisher ...
-
bioRxiv - Biochemistry 2023Quote: ... DHEA sulfate (5-androsten-3β-ol-17-one-3-sulfate) and testosterone (4-androsten-17β-ol-3-one) were purchased from Sigma Aldrich. 11β-hydroxyandrostenedione (11β-hydroxy-4-androstene-3,17-dione) ...
-
bioRxiv - Cell Biology 2022Quote: Serum IL-6 levels were quantified using a commercial mouse IL-6 ELISA kit (RAB0308, Sigma) according to the manufacturer’s instructions and analyzed using spectra-iMAX (Molecular Devices).
-
bioRxiv - Immunology 2022Quote: Serum insulin was determined using a rat/mouse insulin ELISA kit (Millipore, Billerica, Merck KGaA, USA) as instructed ...
-
bioRxiv - Genetics 2021Quote: ... Mouse plasma insulin and leptin levels were determined by using Rat/ Mouse Insulin ELISA Kit (Millipore, EZRMI-13K for insulin and EZML-82K for leptin ...
-
bioRxiv - Microbiology 2021Quote: ... the antibodies isotypes were determined by ELISA using a mouse Ig isotyping kit (ISO-2, SIGMA).
-
bioRxiv - Cell Biology 2021Quote: ... cells were lysed in 125 μl of lysis buffer provided with a CAT ELISA kit (Sigma). CAT expression and Renilla luciferase activities were measured and the ratio was calculated.
-
bioRxiv - Physiology 2020Quote: ... Insulin release from islets was measured as described with Rat/Mouse Insulin ELISA kit (Millipore Sigma) (26).
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were routinely subjected to mycoplasma testing using the Mycoplasma PCR ELISA kit (Sigma Aldrich, 11663925910) and tested negative.
-
bioRxiv - Cell Biology 2022Quote: ... Arteries were then stimulated with increasing concentrations of serotonin (5-HT, from 10 -8 to 3· 10 -5 M, Sigma), endothelium-dependent vasodilator acetylcholine (ACh ...
-
bioRxiv - Microbiology 2021Quote: ... glucose were pelleted by centrifugation and resuspended in 5 mL YNBNAG11 pH 5.1 containing 5 μM 3-MB-PP1 (EMD MILLIPORE) or DMSO as a vehicle control ...
-
bioRxiv - Biochemistry 2021Quote: An RNA oligonucleotide (5′ -UUUUCAUGCUACGCGUAGUUUUCUACGCG-3′; 4N) with Cyanine 5.5 at the 5′-end was obtained from Millipore Sigma (USA). The RNA scaffold was annealed in 20 mM HEPES ...
-
bioRxiv - Neuroscience 2022Quote: ... or DMSO 0.1% as vehicle was evaluated using a MTT (3-(4, 5-dimethylthiazol-2-yl)-2-5-diphenyltetrazolium bromide) (Sigma-Aldrich) assay as described in (Sanz et al. ...
-
bioRxiv - Immunology 2023Quote: ... Single-cell suspensions (some of which were pooled from tumors harvested from 2-3 mice) were stimulated for 5 h with PMA (5 ng/ml, Sigma) and ionomycin (500 ng/ml ...
-
bioRxiv - Genomics 2023Quote: ... with 3 mL of cell culture media added to each well and treated with 5 µM 5-azacytidine (A2385, Sigma), 10 µM dexamethasone (D1756 ...
-
bioRxiv - Cell Biology 2020Quote: ... Triglyceride Assay kit (Sigma, TG-5-RB), and Glucose (GO ...
-
bioRxiv - Immunology 2021Quote: ... The plates were washed (5 times with PBS-T) and AP substrate (Sigma) was added ...
-
bioRxiv - Cell Biology 2021Quote: ... plates were incubated in 5% (v/v) Hellmanex III solution (Z805939-1EA; Sigma) overnight ...
-
bioRxiv - Immunology 2021Quote: ... The plates were washed (5 times with PBS-T) and AP substrate (Sigma) was added ...
-
bioRxiv - Immunology 2021Quote: ... The plates were then washed 3 times with PBS containing 0.05% Tween-20 (Sigma-Aldrich), blocked with 150 mL ELISA/ELISPOT Diluent (Life Technologies Corporation ...
-
bioRxiv - Cancer Biology 2020Quote: ... The plates were blocked for non-specific binding with 3% BSA (200 μL/well, Millipore) for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... mouse splenocytes were plated at 3 × 105 / well into 96-well filtration plates (Millipore, USA) pre-coated with capture antibodies and stimulated with 5 µg / well purified JEV or ZIKV particles for 60 h at 37 °C ...
-
bioRxiv - Immunology 2021Quote: ... The plates were developed with commercially available 3-Amino-9-ethylcarbazole (AEC) substrate (Sigma-Aldrich). The observed spots were counted using an ELISPOT plate reader by ZellNet and the final data was reported as spot forming cells (SFC ...
-
bioRxiv - Immunology 2023Quote: ... the immuno-plates were blocked with 3% bovine serum albumin (BSA, Sigma, Cat.#0336-50ML) in 1 × PBS supplemented with 0.1% (v:v ...
-
bioRxiv - Immunology 2024Quote: ... The coated plates were then washed 3 times with PBS-T (Sigma cat. # P3563-10PAK) and incubated overnight with 60 μl of a dilution of H6N2 and 60 µl of 2-fold serial dilution of serum ...
-
bioRxiv - Cell Biology 2023Quote: ... plates were treated with 3-amino-propyltrimethoxysilane (diluted 1:2 with PBS; Sigma-Aldrich/Merck) for 15min at RT ...