Labshake search
Citations for Millipore Sigma :
1 - 50 of 10000+ citations for Estrone 3 Glucuronide E1G ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... rats received daily subcutaneous injections of 10 μg estrone (Sigma-Aldrich) in 0.1 ml sesame oil ...
-
bioRxiv - Microbiology 2022Quote: ... gonorrhoeae growth on GC-IsoVitaleX agar plates. Estrone (i. e., E) and 17-α-hydroxyprogesterone (i. e., P2) (both from Sigma) were solubilized in 2-BtOH ...
-
bioRxiv - Biochemistry 2019Quote: Ethyl glucuronide standard (100 ug/mL, Sigma Aldrich) was dried down in an Amber autosampler vial using a SpeedVac® Concentrator ...
-
bioRxiv - Immunology 2022Quote: A 96 well ELISA plate was coated with bovine fetuin (5 μg/mL; Sigma) in carbonate buffer overnight ...
-
bioRxiv - Plant Biology 2021Quote: ... a 4-methylumbelliferyl b-D-glucuronide (MUG) (Sigma-Aldrich) assay was carried out as previously described (He et al. ...
-
bioRxiv - Immunology 2020Quote: ... The ELISA plates were washed and blocked with 5% Foetal Bovine Serum (FBS, Sigma, F9665) in 1x PBS/0.1% Tween 20 for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... Biotinylated proteins were captured in ELISA plates precoated with 5 μg/ml of avidin (Sigma) in Na2CO3-NaHCO3 buffer (pH 9.6 ...
-
bioRxiv - Immunology 2020Quote: ELISA plates (Cat. M5785, Sigma Aldrich) were first coated overnight at 4°C with 10μg/ml of each B cell peptide epitope ...
-
bioRxiv - Biochemistry 2020Quote: ... Taurocholic acid sodium salt (97% pure) and estrone-3-sulfate sodium salt (containing 35% Tris stabilizer) were purchased from Sigma Aldrich (St. Louis, MO). Rosuvastatin (98% pure ...
-
bioRxiv - Plant Biology 2020Quote: ... plants were incubated overnight at 37°C in GUS buffer (3 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronide [Duchefa Biochemie, Haarlem, The Netherlands], 0.1% v/v Triton X-100 [Sigma, Steinhaim ...
-
bioRxiv - Molecular Biology 2022Quote: ... The MUG (4-Methylumbelliferyl β-D-glucuronide) (Sigma-Aldrich, M9130) and luciferase assay system (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... Biotinylated proteins were captured in ELISA plates pre-coated with 5 µg/mL of Avidin (Sigma) in Na2CO3/NaHCO3 buffer pH 9.6 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5’-GACAUAUUUGAUAAACUUAAA-3’, 5’-GUUAUCAGUCUGAGCCAGG-3’), human DRP1 (5’-GCAGAAGAAUGGGGUAAAU-3’, 5’-UCCGUGAUGAGUAUGCUUU-3’, 5’-GAGGUUAUUGAACGACUCA-3’) non-targeting scrambled siRNA (Sigma, SIC001-1NMOL) for 48-72 hours using Lipofectamine RNAiMAX (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... media was collected and used to measure secreted Cxcl1 protein on an ELISA plate according to the KC/Cxcl1 ELISA kit manufacturer’s instructions (Sigma-Aldrich #RAB0117). Absorbance values at 450 nm were measured with a Tecan plate reader ...
-
bioRxiv - Biochemistry 2024Quote: ... Tspan12 siRNA duplexes (#1: 5’-GCUUAUCUUUGCCUUCUCCTT-3’ and 5’-GGAGAAGGCAAAGAUAAGCTT-3’; #2: 5’-AUGAGGGACUACCUAAAUATT-3’ and 5’-UAUUUAGGUAGUCCCUCAUTT-3’) (Sigma) using Lipofectamine RNAiMax (Thermo Fisher ...
-
bioRxiv - Cell Biology 2022Quote: ... pLKO.1-puro-CMV-tGFP plasmids targeting SNX5 (5’-ACTATTACAATAGGATCAAAG-3’, 5’-CTGAGTATCTCGCTGTGTTTA-3’) and SNX6 (5’-AGTAAAGGATGTAGATGATTT-3’, 5’-GCCGAAACTTCCCAACAATTA-3’) (Sigma-Aldrich) were lentivirally transduced ...
-
bioRxiv - Cancer Biology 2021Quote: ... MYC forward 5’-TGAGGAGGAACAACAAGATG-3’ and reverse 5’-ATCCAGACTCTGACCTTTTG-3’ and GAPDH forward 5’-CTTTTGCGTCGCCAG-3’ and reverse 5’-TTGATGGCAACAATATCCA-3’) (Sigma-Aldrich), the Radian SYBR Green Lo-ROX qPCR Kit (Alkali Scientific ...
-
bioRxiv - Immunology 2022Quote: ... The sequences of forward and reverse primers for εGLT (fw: 5′-CTGTCCAGGAACCCGACAGA-3′; rev: 5′-TGCA GCAGCGGGTCAAG-3′) and γ1GLT (fw: 5’-CCAGGGCAGGGTCAGCA-3’; rev: 5’-GGTGCTCTTGGAGGAGGGT-3’) (Sigma-Aldrich) and their corresponding FAM-labelled MGB probes (εGLT ...
-
bioRxiv - Cell Biology 2019Quote: The Cy®3 Mono 5-pack kit (Sigma) was used for the labeling of PROTAMINE ...
-
bioRxiv - Immunology 2022Quote: ... TNFa and CTX-I were measured using the mouse SAA-3 ELISA kit (Sigma-Aldrich), LEGEND MAX™ Mouse TNF-α ELISA Kit (BioLegend ...
-
bioRxiv - Immunology 2020Quote: ... All ELISA plates were developed with TMB (Sigma) and stopped with 1N sulfuric acid ...
-
bioRxiv - Cell Biology 2024Quote: 96-well ELISA plates (Sigma-Aldrich, Cat#CLS3795) were coated with rat anti-RIPK3 (clone IH12 ...
-
bioRxiv - Plant Biology 2023Quote: ... SD-WLH plates were supplemented with either 2.5 or 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich).
-
bioRxiv - Microbiology 2021Quote: ... together with the p-nitrophenyl-β-D-glucuronide substrate (PNPG; Sigma Aldrich) at a concentration of 600 μg/mL ...
-
bioRxiv - Immunology 2020Quote: ... The polyreactivity of hybridoma-obtained IgA was tested by adding them to ELISA plates that were coated with common antigens dissolved in PBS before coating ELISA plates: Lipopolysaccharide (Sigma-Aldrich; L4391), double stranded DNA (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... which was performed using 4-methylumbelliferyl-β-D-glucuronide (4-MUG; Sigma Aldrich) as a substrate ...
-
bioRxiv - Cell Biology 2019Quote: ... (TDP43: 5’-gcaaagccaagaugagccu-3’ and EGFP control: 5’-gcaccaucuucuucaagga-3’; Sigma). Silenced cells were collected by trypsinization ...
-
bioRxiv - Genomics 2020Quote: ... into 384 well plates containing 3 μl of Smart-seq3 lysis buffer (5% PEG (Sigma), 0.10% Triton X-100 (Sigma) ...
-
bioRxiv - Bioengineering 2022Quote: 4-Nitrophenyl β-D-glucuronide (4-NPG, CAS no. 10344-94-2) (Sigma-aldrich) was prepared in 50 mM sodium phosphate buffer (Na-PB ...
-
bioRxiv - Microbiology 2019Quote: ... Activity of extracted bacterial GUS was measured by hydrolysis of phenolphthalein glucuronide (Sigma-Aldrich) to free phenolphthalein and quantified by spectrophotometry (69) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-GATCCCCAAATCT-3’ and 5’-GATCAGAT[BtndT]TGGG-3’ with 5’ end phosphate (Sigma-Aldrich), were annealed (81 µl of each Oligo 100 µM ...
-
bioRxiv - Immunology 2021Quote: ... Nunc-Immuno™ MicroWell™ 96 well ELISA plates (Millipore) were coated overnight with 50 μl per well of 2ug/ml RBD-His or Spike-His protein in carbonate buffer pH9 ...
-
bioRxiv - Immunology 2021Quote: ... Elisa plates were coated with 100ug/ml of OVA (Sigma) prepared in a coating buffer (Na2CO3 ...
-
bioRxiv - Molecular Biology 2019Quote: ... ELISA 96-well plates (Nunc-Immuno™,Sigma-Aldrich®) were coated with 200 ng of purified anti-NS1 monoclonal antibody in carbonate buffer (0.05 M ...
-
bioRxiv - Microbiology 2021Quote: ... 5′5′-Tetramethylbenzidine (TMB) Liquid Substrate System for ELISA (Sigma-Aldrich, Taufkirchen, Germany) was added until a colour change was observed ...
-
bioRxiv - Neuroscience 2021Quote: ... antisense: 5’-ACCGAUUGAAGUUAAUGUC-3’), Myef2 (sense: 5’-CUUUGGUGGAGUUGGCCGA-3’, antisense: 5’-UCGGCCAACUCCACCAAAG-3’) or siRNA universal negative control (SIC001, Sigma-Aldrich) were purchased from Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Microbiology 2019Quote: ... and primers p181 (5’-GCGAAGATAACAGTGACTCTA-3’ and p54 (5’-CGGCTCTGATTAAATTCTGAAG-3’) (Sigma, UK).
-
bioRxiv - Plant Biology 2022Quote: ... GUS quantification was carried out using 4-methylumbelliferyl-β-D-glucuronide (4-MUG; Sigma-Aldrich) as the substrate.
-
bioRxiv - Microbiology 2021Quote: ... The lysate was mixed with 160 µl of 6mM p-nitrophenyl β-D-glucuronide (Sigma) and incubated at 37°C ...
-
bioRxiv - Genetics 2020Quote: ... The lysate was mixed with 160 ul of 6mM p-nitrophenyl β-D-glucuronide (Sigma) and incubated at 37°C ...
-
bioRxiv - Microbiology 2023Quote: Nunc MaxiSorp flat bottom 96-well ELISA plates (Sigma-Aldrich, M9410) were coated with 50 ng/well of recombinant CCHFV Gn protein (Creative Diagnostics ...
-
bioRxiv - Cell Biology 2023Quote: ... 5-fluorouracil (5-FU) : 3 µM (F6627; Sigma), cisplatin (CDDP ...
-
bioRxiv - Genetics 2021Quote: ... Mouse neural progenitor cells were routinely passaged 1:2-1:4 every 3-5 days using Accutase and maintained in NS expansion medium on laminin-coated plates (Sigma, 3 μg/ml). Both mESCs and mNPCs were incubated at 37 °C and 5% CO2 ...
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Microbiology 2023Quote: ... 5 µL of an overnight culture was spotted onto BHI agar plates supplemented with 3% gelatin (Sigma). Plates were incubated at 37 °C overnight and then at 4 °C to enable better visualization of the gelatinase-positive phenotype ...
-
bioRxiv - Cell Biology 2022Quote: ... were detected by ELISA Kits (from Millipore) within 24h according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... STAR EGFR ELISA Kit (Millipore, Billerica, MA) and followed by manufacturer’s recommended protocol ...
-
bioRxiv - Genomics 2023Quote: ... Cardiac Muscle ELISA Kit (RAB0634, Sigma-Aldrich), and 100 uL of cell culture supernatant after 24 hours of treatment with each drug at 0.5 μM ...
-
bioRxiv - Pathology 2021Quote: ... or cell culture supernatants were quantified by ELISA methods (Activin A ELISA kit, Sigma, St ...