Labshake search
Citations for Millipore Sigma :
8501 - 8550 of 10000+ citations for Recombinant Human Pentraxin 3 Long His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... from 1:50 to 1:51200 in PBS containing 2% skimmed milk were added followed by ALP-conjugated anti-human IgG (A9544; Sigma) at 1:10,000 dilution ...
-
bioRxiv - Neuroscience 2021Quote: ... For analysis of human OL 3000-4000 cells were seeded on wells coated with 5-10 µg/ml mouse-laminin (#L2020, Sigma) and 0.025 % poly-L-lysine (#P4707 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Murine mCherry-G166 GSCs glioma cells or human G166 GSCs labelled with a Red Fluorescent Cell kit PKH26 (Sigma-Aldrich) were injected into NOD SCID mice ...
-
bioRxiv - Neuroscience 2020Quote: ... the blots were incubated with secondary antibody horseradish peroxidase (HRP)-conjugated goat anti-human Fab IgG (H+L) (Sigma, A0293) diluted 1:10000 in blocking buffer for 1 h at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... After 2 h at RT plates were washed three times and incubated with anti-human Fab specific-HRP conjugated secondary antibody (Sigma) for 1 h at RT ...
-
bioRxiv - Pathology 2021Quote: ... PBMC-granulocytes (105) and platelets (105) of mice or human samples from different treatments as per manufacture protocol (Sigma Aldrich, USA catalog no ...
-
bioRxiv - Biochemistry 2020Quote: Human embryonic kidney (HEK) 293 cells were purchased from ATCC and HEK-293 PDE4A4 stable cell line established by Millipore. HEK-293 and HEK-293 PDE4A4 cells were cultured in high-glucose Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were washed two times and horseradish peroxidase (HRP)-conjugated goat anti-human IgG antibody (Sigma Aldrich, St. Louis, MO) was used at a 1:5,000 dilution and incubated at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: All laboratory-adapted strains were maintained in human foreskin fibroblasts (HFF) cells in high glucose DMEM with sodium bicarbonate (Sigma) supplemented with 5% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 5% heat-inactivated AB human serum, antibiotics (penicillin, 200 U/ml; and streptomycin, 0.1 mg/mL) and L-glutamine (1 mM) (Sigma-Aldrich) at a concentration of 1 x 107 cells/mL ...
-
bioRxiv - Immunology 2021Quote: ... that utilizes the same human antibodies.12 Antibodies were prepared 1:500 in carbonate-bicarbonate coating buffer (SRE0034, Sigma-Aldrich), added to each well of a Costar 96-well Assay plate (3369 ...
-
bioRxiv - Cell Biology 2020Quote: Bacterial expression vectors for human Arf1 (UniProtKB: P84077) and Arf6 (UniProtKB: P62330) were constructed using a pET-41 Ek/LIC vector kit (Novagen), as described for protein expression of human Rab-family small GTPases (Tamura and Mima ...
-
bioRxiv - Microbiology 2019Quote: ... the slides were incubated for 2 hours at room temperature with 1 µg/mL Cy3-conjugated goat anti-human IgG (H+L) (Sigma) and washed again ...
-
bioRxiv - Microbiology 2020Quote: Freshly isolated purified human neutrophils were seeded on 12 mm Poly-D-lysine-coated (0.01 % solution overnight; Sigma-Aldrich; P7405) coverslips at a concentration of 1 × 106 cells/ml (5 × 105 cells/mL per well ...
-
bioRxiv - Cancer Biology 2021Quote: ... Kelly human NB cells were transduced with the viral supernatant in the presence of 8 μg/ml polybrene (Sigma-Aldrich) and 24 h later selected using puromycin (1 µg/ml ...
-
bioRxiv - Cell Biology 2021Quote: MEFs expressing mEmerald-β-actin were plated on the coverslips coated with 10 μg/mL human plasma fibronectin (EMD Millipore). The coverslips with cells were mounted on the microscope slides for imaging ...
-
bioRxiv - Cell Biology 2021Quote: ... Zygotes were obtained by dissecting the ampulla of the oviduct 24 hours post-injection of human chorionic gonadotropin (hCG) and treated briefly with 1mg/ml of hyaluronidase (Sigma) in M2 medium (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... GMPS were sorted as described above from CD45.1 and cells were cultured in a 12 well plate pre-coated with human fibronectin (EMD Millipore) in RPMI1640 media + 10% Fetal Bovine Serum (FBS) ...
-
bioRxiv - Biophysics 2021Quote: ... the cDNA sequence coding for the intracellular portion of human EphA2 (residues S570-D976) was cloned into the pET29a(+) vector (Novagen) to express EphA2 protein with a C-terminal 6xHis-tag ...
-
bioRxiv - Microbiology 2022Quote: ... These wells were washed five times using 1× PBST and followed by addition 50 μl/well of anti-human IgG horseradish peroxidase (HRP) (Sigma) diluted in Stabilzyme Noble (Surmodics) ...
-
bioRxiv - Neuroscience 2022Quote: The MILLIPLEX® MAP human amyloid beta and tau magnetic bead panel 4-plex ELISA kit (Millipore, Burlington, MA, USA) and the Bio-Plex 200 System instrument (Biorad ...
-
bioRxiv - Genomics 2022Quote: Multiplexed cytokine quantification was profiled using the 38-plex Human Cytokine/Chemokine Magnetic Bead Panel on the Luminex MAGPIX instrument (Millipore). IL8 was measured with Human IL8/CXCL8 DuoSet ELISA (R&D Biosystems ...
-
bioRxiv - Cell Biology 2022Quote: A mix of diploid and tetraploid cells (see Induction of tetraploidy in human cell lines section) were incubated with 2µg/ml Hoescht 33342 (94403 from Sigma Aldrich) for 1hr at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... The sample was then washed twice with 2X SSC and digested by 3 incubations (10 minutes for mouse and 5 min for human) with digestion buffer containing 1% (w/v) sodium-dodecyl-sulfate (SDS, Sigma), 20 mM Tris HCl (Thermo) ...
-
bioRxiv - Immunology 2022Quote: A similar protocol was performed for human NK cells with the exceptions that RPMI plus 10 % FBS and penicillin and streptomycin (Sigma) and 5 ng/ml recombinant human IL-15 (Preprotech ...
-
bioRxiv - Cancer Biology 2022Quote: ... we used Herceptin® at 5 µg/ml and goat anti-human Alexa Fluor® 647 (Sigma, St. Louis, MO) at 1:750 dilution ...
-
bioRxiv - Bioengineering 2022Quote: K32 cells (K562 cells expressing human CD32) were transduced with lentivirus expressing WT DLL4 or DeltaMAX by spin-infection using 8 μg/mL polybrene (Millipore). Seventy-two hours after transduction ...
-
bioRxiv - Immunology 2022Quote: ... and Goat Anti-Human IgM Fc5μ Fragment specific HRP conjugated secondary antibody for IgM (Cat# AP114P, EMD Millipore, Burlington, MA). After the incubation ...
-
bioRxiv - Cancer Biology 2022Quote: ... shRNA knockdown vectors for mouse Mdm2 (TRNC0000302276) or human MDM2 (TRCN0000355726, TRCN0000355727, TRCN0000355728, TRCN0000003378 and TRCN0000003380) were from Sigma Aldrich. The pBabe-puro expression vector for CA-AMPK has been described53.
-
bioRxiv - Microbiology 2021Quote: ... Cytokine quantification was performed using a Human Cytokine/Chemokine/Growth Factor Panel A 48-Plex Premixed Magnetic Bead Multiplex Assay (Merck Millipore), using the Luminex MAGPIX System in 96-well plate format ...
-
bioRxiv - Microbiology 2021Quote: ... Non-adherent cells were washed and the remaining monocytes were maintained in DMEM high glucose with 5% human serum (HS; Millipore) and P/S ...
-
bioRxiv - Molecular Biology 2020Quote: ... mt1 and mt2 were generated by inserting the ORF of human TruB1 and its mutants into the pET22b vector (Merck Millipore) at the NdeI and XhoI sites ...
-
bioRxiv - Neuroscience 2021Quote: ... pSIH-mCherry-KDEL construct expressing lentiviruses were added to the suspension of motoneurons before plating on polyornithine-(PORN) and human merosin-coated (CC085, Merck-Millipore) plates ...
-
bioRxiv - Cell Biology 2021Quote: ... The membrane was washed with PBS-Tween 20 0.05% and incubated with peroxidase-conjugated anti-human IgG antibody (Sigma, USA) at a dilution of 1 ...
-
bioRxiv - Cell Biology 2021Quote: Washed platelets (160 μL with 0.5×106 platelets/μL) were analyzed in the presence (collagen) or absence (thrombin) of 70 μg/mL human fibrinogen (Sigma). Light transmission was recorded on a four-channel aggregometer (Fibrintimer ...
-
bioRxiv - Biochemistry 2021Quote: ... Removal of the GST-tag from human and zebrafish Vps29 was performed using on-column cleavage with thrombin (Sigma-Aldrich) overnight at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... SUM149PT were grown in SUM medium (1:1 mix of DMEM/F12 and Human Mammary Epithelial Cell Growth Medium (Sigma), 5% FBS ...
-
bioRxiv - Neuroscience 2021Quote: ... followed 48 hours later by intraperitoneal injection of 5 IU human chorionic gonadotropin (PMS from SIGMA, HGC from Millipore USA). Mouse zygotes were obtained by breeding B6/CBA stud males with superovulated B6/CBA females at a 1:1 ratio ...
-
bioRxiv - Neuroscience 2021Quote: ... followed 48 hours later by intraperitoneal injection of 5 IU human chorionic gonadotropin (PMS from SIGMA, HGC from Millipore USA). Mouse zygotes were obtained by breeding B6/CBA stud males with superovulated B6/CBA females at a 1:1 ratio ...
-
bioRxiv - Neuroscience 2022Quote: ... This cell line allows the induction of Ngn2 expression and the puromycin resistance gene by the addition of Doxycycline for differentiation into neurons.30 Human iPSCs were maintained in feeder-free culture using Matrigel (Sigma) coated plastic dishes and StemFlex medium (StemCell ...
-
bioRxiv - Microbiology 2022Quote: ... gonococci were incubated (5 min and in parallel with the infections outlined above) in SH- and antibiotic-free cell culture medium spiked with normal human complement (Sigma) to a final concentration of 6% ...
-
Inhibition of major histocompatibility complex-I antigen presentation by sarbecovirus ORF7a proteinsbioRxiv - Microbiology 2022Quote: ... and human alveolar basal epithelial A549 cell line were maintained in DMEM supplemented with 10% fetal bovine serum (Sigma F8067) and gentamicin (Gibco) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Two pLKO.1 lentiviral vectors encoding for specific shRNA for two human MAPK7 mRNA sequences were used (TRCN0000010262/pLKO.1 and TRCN0000010275/pLKO.1, Sigma). Lentiviral particles were generated in HEK-293 cells by co-transfecting the virion vectors (psPAX2 and pMD2G ...
-
Structure and Neutralization Mechanism of a Human Antibody Targeting a Complex Epitope on Zika VirusbioRxiv - Microbiology 2022Quote: ... Plates were washed with TBS containing 0.2% Tween and incubated for 1 hour at 37°C with Goat anti-human Fc (Sigma, A9544) or Fab (Jackson immunoResearch AB_2337617 ...
-
bioRxiv - Cell Biology 2019Quote: Undifferentiated SGBS cells were plated at 50 % confluence in 6-well plates and infected with commercial lentiviral particles targeting either human ABCG1 (TRCN0000420907; Sigma) (TAGGAAGATGTAGGCAGATTG ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were trypsinized and seeded on top of glass coverslips coated with 10 μg/ml of human fibrinogen (Sigma-Aldrich). Cells were fixed two hours later with 2% formaldehyde (Tousimis ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were transfected with human ASCL1 stealth siRNA (129901-HSS100744, Thermo-Fisher) using X-tremeGENE siRNA Transfection Reagent (4476115001, Sigma) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... Concentrations of 29 cytokines/chemokines were measured in 2-4 biological replicates using MILLIPLEX Map Human Cytokine/Chemokine Magnetic Bead Panel (HCYTMAG-60K-PX29, #Millipore) according to manufacturer’s protocol.
-
bioRxiv - Microbiology 2021Quote: ... Samples were then diluted 1:2 in serum matrix for analysis with Milliplex Non-Human Primate Magnetic Bead Panel as per manufacturer’s instructions (Millipore Corporation). Concentrations for each cytokine were determined for all samples using the Bio-Plex 200 system (BioRad Laboratories Inc.).
-
bioRxiv - Microbiology 2021Quote: ... ScAb or mAb samples were incubated with the antigen in doubling dilutions and the binding was detected using anti-Human C Kappa horseradish peroxidase (HRP) conjugated secondary antibody (Sigma) (for scAbs ...