Labshake search
Citations for Millipore Sigma :
8251 - 8300 of 10000+ citations for Recombinant Mouse TNFRSF9 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... Protein was transferred to a methanol-treated polyvinylidene difluoride membrane (Millipore Sigma) using a Mini Trans Blot Electrophoretic Transfer Cell (Biorad ...
-
bioRxiv - Neuroscience 2024Quote: ... Protein concentration was determined using a BCA assay kit (#QPBCA, Sigma-Aldrich). Protein samples were mixed with DTT (#D9779-10G ...
-
bioRxiv - Neuroscience 2024Quote: ... Protein concentrations in the collected fractions were measured using Bradford reagent (Sigma).
-
bioRxiv - Pathology 2024Quote: ... Proteins were transferred to polyvinylidene fluoride (PVDF) membranes (Immobilon-P, Merck Millipore), blocked with 5% non-fat dry milk ...
-
bioRxiv - Biophysics 2021Quote: ... The primary antibodies were mouse monoclonal anti–α-tubulin antibody (T5168, Sigma), or/and rabbit anti-Tom20 antibody (HPA011562 ...
-
bioRxiv - Neuroscience 2021Quote: ... and incubated in biotinylated goat anti-mouse secondary antibody (Sigma, B0529,1:200) for 1 hour ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse monoclonal anti-p75NTR (clone ME20.4) (Millipore Cat#05-446, RRID: AB_309737) and mouse monoclonal anti-PSA-NCAM (clone 2-2B ...
-
bioRxiv - Cancer Biology 2021Quote: ... The cells were incubated with anti-GM130 antibody (clone 4A3 Millipore, Mouse), or calnexin (mouse mAb ...
-
bioRxiv - Cell Biology 2021Quote: ... and Duolink In Situ PLA Probe Anti-Mouse MINUS (DUO92004, Sigma-Aldrich) we incubated with coverslip 60 min at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Primary antibodies used were mouse anti-α-SMA (clone 1A4, Sigma-Aldrich) 1:10 000 ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse monoclonal ANTI-FLAG® M2 Antibody (Sigma-Aldrich, F1804, 1:4000), mouse monoclonal anti-HA-tag Antibody (Moravian ...
-
bioRxiv - Cell Biology 2019Quote: ... Mouse monoclonal anti-α-Tubulin (Cat. Nr. T9026) was purchased from Sigma. Mouse monoclonal anti-clathrin heavy chain (CHC ...
-
bioRxiv - Cell Biology 2020Quote: The mouse anti-ubiquitin (FK2) used for immunofluorescence was from EMD Millipore. Hoechst dye was from Sigma and Alexa Fluor-conjugated secondary antibodies were from Molecular Probes ...
-
bioRxiv - Cell Biology 2020Quote: Antibody anti-acetylated tubulin (clone 6-11B-1, mouse monoclonal, Sigma Aldrich), anti-Poly-Glu tubulin (1:1000 ...
-
bioRxiv - Immunology 2021Quote: ... secondary antibody: anti-mouse-Alexa 594 at 1:1000 (Millipore Sigma, F0257). Images were taken at 100X magnification on Lionheart (Biotek).α-SMA area was analyzed using ImageJ (NIH) ...
-
bioRxiv - Immunology 2021Quote: ... followed by a mouse anti-rabbit Alexa Fluor 488 secondary antibody (Sigma) and Vybrant DyeCycleViolet Stain (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse livers were fixed in 10% formalin buffer saline (HT501128, Sigma Aldrich) for 24h at room temperature before paraffin embedding ...
-
bioRxiv - Molecular Biology 2021Quote: ... β-actin was used as a loading control (mouse Mab Sigma A2228). Five U/μg DNA of DNase (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mouse anti-cadherin-11 (clone 16A) antibody was from Millipore (Billerica, MA). Mouse anti-cadherin-11 (clone 5B2H5) ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-α-tubulin (1:10 000; Sigma-Aldrich Cat# T8328, RRID:AB_1844090), rhodamine peanut agglutinin (1:1000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and mouse anti-Lamin A/C at 1:50 (Sigma-Aldrich #MABT1340).
-
bioRxiv - Developmental Biology 2021Quote: ... and mouse anti-acetylated-a-tubulin antibody (T7451, 1:1000 dilution, Sigma) were used for immunofluorescence ...
-
bioRxiv - Neuroscience 2022Quote: ... for Mouse 448 and human experiments or 1 mg/ml Hoechst (Sigma) for the mouse atlas experiments ...
-
bioRxiv - Immunology 2022Quote: ... and tubulin antibody (1:3000 dilution, B-512, mouse monoclonal, Sigma-Aldrich), respectively ...
-
bioRxiv - Plant Biology 2022Quote: ... a monoclonal GFP antibody raised in mouse (Sigma-Aldrich, cat. no. G1546) and a monoclonal cMyc antibody raised in mouse (Santa Cruz ...
-
bioRxiv - Immunology 2022Quote: ... the DuolinkTM InSitu Orange Starter Kit Mouse/Rabbit (DUO92102) from Sigma Aldrich was used ...
-
bioRxiv - Neuroscience 2022Quote: ... or mouse anti-TPH2 primary antibody (1:100 dilution, T0678, Sigma-Aldrich). The secondary antibodies used were donkey anti-mouse Alexa 488 (1:1000 ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were stained with primary mouse antibodies anti-FLAG M2 (Sigma, F1804) or anti-dsRNA J2 (Jena Bioscience ...
-
bioRxiv - Biochemistry 2022Quote: ... Membranes were incubated with primary antibody (mouse anti-FLAG M2, Sigma F1804) at 1:1000 dilutions in 3% milk-TBS-T overnight rotating at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-tyrosine hydroxylase (1: 5000; Sigma, St. Louis, MO, Cat#T1299), chicken anti-tyrosine hydroxylase (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-NeuN (clone A60, 1:500; Millipore, Billerica, MA Cat#MAB377), rat anti-BrdU (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies assessed include mouse anti-ATXN3 (1H9) (1:500; MAB5360; Millipore) and rabbit anti-Olig2 (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... or mouse anti-GFAP (1:500 dilution; Milipore Sigma cat. no. G3893) + rabbit anti-VCAM1 (1:200 dilution ...
-
bioRxiv - Neuroscience 2021Quote: ... with a monoclonal anti-NeuN antibody (1:500; Mouse, MAB377, Merck Millipore) for brain sections in 0.5x blocking buffer supplemented with 0.5% Triton X-100 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were incubated with anti-Flag M2 mouse monoclonal antibody (Sigma-Aldrich) diluted 1:400 in blocking solution for 1 h to detect SRVB/A reporters ...
-
bioRxiv - Molecular Biology 2021Quote: ... Membranes were incubated overnight with mouse anti-GFP primary antibody (Sigma-Aldrich) used at 1:1000 dilution ...
-
bioRxiv - Molecular Biology 2021Quote: ... monoclonal mouse anti-FLAG antibody was from Sigma (clone M2, Cat#F1804), mouse anti-GFP was from Roche (Cat# 11814460001) ...
-
bioRxiv - Cell Biology 2022Quote: ... 1:1000 mouse-anti-α-SMA (Millipore; Burlington, MA; Clone ASM-1), 1:2000 mouse-anti-β-actin (Cell Signaling Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... The following antibodies were used: mouse α-tubulin (1:1000, Sigma T9026) and rabbit α-Cenp-C (Pauleau ...
-
bioRxiv - Immunology 2022Quote: ... as primary antibody and goat anti-mouse IgG whole molecule (Sigma # A4416) as secondary antibody.
-
bioRxiv - Microbiology 2020Quote: ... 35 μl monoclonal anti-FLAG M2 antibody produced in mouse (Sigma-Aldrich) was added to the supernatant and incubated for 30 min at 4 °C ...
-
bioRxiv - Genomics 2020Quote: ... We incubated the membrane in Anti-FLAG mouse monoclonal Antibody (Sigma, F3166) and V5 rabbit polyclonal antibody (Santa Cruz ...
-
bioRxiv - Genomics 2020Quote: ... Mouse Embryonic fibroblasts were crosslinked using 1% formaldehyde (Sigma cat. No. F8775) for 10 minutes followed by quenching with 0.125 M Glycine for 5 minutes and lysis with lysis buffer 1 -LB1- (50 mM Hepes KOH pH 7.5 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Horseradish peroxidase-conjugated with anti-rabbit HRP and anti-mouse HRP (Sigma) were the secondary antibodies used ...
-
bioRxiv - Immunology 2019Quote: ... 100 μl/well of peroxidase-conjugated anti-mouse IgG (1/500) (Sigma) in blocking buffer was added and incubated at 37°C for 1 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... Blastocysts were cultured on irradiated mouse embryo fibroblasts (PMEF-N, Millipore Sigma) in ESGRO-2i medium (Millipore Sigma SF016-100 ...
-
bioRxiv - Biochemistry 2019Quote: ... followed by incubation with mouse monoclonal anti-myc antibody (RRID: AB_309938, Millipore) at a 1:2,000 dilution in TBS and 3% (w/v ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Commercial available antibodies are mouse anti-Flag (1:1000, Sigma, M2, F3165), and mouse anti-α-tubulin (1:150 ...
-
bioRxiv - Neuroscience 2019Quote: ... The mouse VDAC1-specific shRNA sequence 2 GTTGGCTATAAGACGGATGAACT (Sigma-Aldrich, Ref. #TRCN0000012391), the VDAC1 shRNA sequence 3 ACCAGGTATCAAACTGACGTTCT (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies were detected by Texas Red-conjugated goat-anti mouse (Sigma) or FITC-conjugated goat anti-rabbit (Sigma ...