Labshake search
Citations for Millipore Sigma :
7451 - 7500 of 10000+ citations for Mouse FAM117A shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: Mammalian lentiviral particles harboring sgRNA-encoding plasmids or cDNA-encoding plasmids were co-transfected with the psPAX2 envelope and VSV-G packaging plasmids into actively growing HEK-293T cells (ATCC) using Xtremegene-HP (Sigma) transfection reagent as previously described (Sarbassov et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were grown in 15cm dishes and transfected with pcDNA3.1-BirA-Myc (2 μg + 8 μg pcDNA3 as a carrier plasmid) or pcDNA3.1-BirA-Myc-ACLY (10 μg) using X-tremeGENE 9 (Sigma, 6365779001). At the time of transfection ...
-
bioRxiv - Biochemistry 2022Quote: Human histones cloned into pET3a (plasmids were a gift from Martin Browne and Andrew Flaus NUI Galway) were expressed separately in Rosetta2 (DE3) pLysS (Novagen). Cell pellets were resuspended in 30 ml histone wash buffer which contained 50 mM Tris/Cl pH 7.5 ...
-
bioRxiv - Cell Biology 2022Quote: ... RAW-ASC cells were transfected with custom CRISPR gRNA plasmid DNA (U6-gRNA:CMV-Cas-9-2A-tGFP) (catalog #CAS9GFFP, Sigma-Aldrich) using the FuGENE HD transfection reagent (catalog #E2311 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... plasmid DNA was linearized with XhoI or HindIII and purified using Montage PCR filter units and Micropure EZ column (Millipore). For pronuclear injection of FVB embryos ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... serial 10-fold dilutions of each plasmid were prepared in 10mM TE buffer with 50ng/μL yeast RNA (Sigma, USA) and each dilution tested via qPCR as previously described ...
-
Optimization and deoptimization of codons in SARS-CoV-2 and the implications for vaccine developmentbioRxiv - Evolutionary Biology 2022Quote: ... About 2×106 cells of HEK293T cells were transfected with 2 ug of plasmids encoding S proteins using polyetherimide (PEI; Sigma). After 16 hours of incubation ...
-
bioRxiv - Microbiology 2022Quote: ... transfected parasites were selected in HFFs for integration of the plasmid into the genome with 25 μg/mL mycophenolic acid (Sigma) and 50 μg/mL xanthine (Sigma) ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid pET-StbA1-75 was constructed by amplifying the truncated stbA gene encoding the first 75 residues of StbA by PCR from plasmid R388 using primers StbAN and StbA75 and introduced between the NdeI and XhoI restriction sites of pET29c (Novagen). Plasmid R388-StbA1-75 was constructed in two steps by replacement of the stb operon in R388 (Table S1 ...
-
bioRxiv - Molecular Biology 2022Quote: Recombinant proteins used for biochemical assays were expressed from pMal-RT plasmids (see above and Table S3. For each protein preparation, E. coli Rossetta2 CapR cells (Novagen) containing freshly transformed expression constructs were plated on LB agar containing ampicillin (100 µg/mL ...
-
bioRxiv - Cancer Biology 2022Quote: Human NSCLC cell lines transiently transfected with either control GFP or one of three different IKKα plasmids were lysed in RIPA buffer (Millipore) supplemented with protease inhibitors (Roche) ...
-
bioRxiv - Biochemistry 2024Quote: ... The SMC1A or SMC3 HDs-coding plasmids were respectively co-transformed with the RAD21C- or RAD21N-coding plasmids into chemically competent Escherichia coli BL21(DE3) cells (Novagen). Co-transformed cells were selected using the appropriate antibiotics ...
-
bioRxiv - Biochemistry 2024Quote: ... The plasmids expressing mCherry-DYRK1B and eGFP-NFATc1 were transiently co-transfected for 48 h with PEI Prime (Sigma-Aldrich). Cells were pre-treated with inhibitor AZ191 (10 μM ...
-
bioRxiv - Genetics 2024Quote: Serial 10-fold dilutions of logarithmic yeast cells were spotted on fresh synthetic dextrose (SD)-complete (or SD lacking a specific amino acid to preserve the plasmid) plates with or without different concentrations of methyl methanesulfonate (MMS) (Sigma) and incubated at 30°C for 3 days ...
-
bioRxiv - Neuroscience 2023Quote: ... a 1kb HB9 promoter fragment (gift from Hynek Wichterle) controlling the expression of myristoylated GFP was inserted into a donor plasmid specific for the AAVS1 locus (Sigma). Subsequently ...
-
bioRxiv - Neuroscience 2023Quote: ... The uterine horns were exposed by laparotomy and the DNA plasmids (1 μg/μl) with 0.01% Fast Green dye (Sigma Aldrich) were injected in the lateral ventricle using a glass capillary (B100-58-10 ...
-
bioRxiv - Neuroscience 2023Quote: ... from pUAST-FUS or pUAST-FUS-RRMmut were cloned into the multiple cloning site (XhoI and BamHI) of the plasmid vector pET-15b (Novagen) (Nomura et al. ...
-
bioRxiv - Microbiology 2023Quote: The cDNA for AFF4 (also known as MCEF) amino acids 1-715 was cloned into pet-6HIS- 11d plasmid (Novagen) and expressed in E ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... A constant amount of plasmid cDNA (15 μg) was transfected into human embryonic kidney cells 293 T (HEK-293T) using polyethylenimine (PEI; Sigma) in a 1:2 weight ratio in 10 cm plates ...
-
bioRxiv - Biochemistry 2023Quote: ... UniProtKB Q55891) was a gift from Jeffrey Tabor.44 The plasmid pACYC-PebS-HO1 was constructed in pACYCDeut-1 (Novagen) using the HO1 gene from pSR43.6r and the PebS gene from Prochlorococcus phage P-SSM2 (UniProtKB Q58MU6 ...
-
bioRxiv - Genomics 2023Quote: ... and 8 µg of the plasmid of interest were mixed with 200 µl of CaCl2 (1 M, Sigma, 21115-100ML). Volume was completed with sterile water up to 800 µl ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were transfected with 1-2 µg of pcDNA5 FRT/TO plasmids containing the gene of interest using GeneJuice transfection reagent (Cat#70967, Merck Millipore) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... together with packaging plasmids pGagpol (10 μg) and pEnv (2 μg) (both courtesy of A. Leutz, Berlin) and 25 μM chloroquin (#6628, Sigma). Thereafter ...
-
bioRxiv - Microbiology 2023Quote: ... A single colony with two plasmids was grown in liquid LB medium supplemented with 100 μg/mL ampicillin (Sigma-Aldrich) and 20 μg/mL chloramphenicol (AppliChem ...
-
bioRxiv - Biochemistry 2023Quote: The NP gene from strain A/WSN/33 (H1N1) with a His-tag at its C-terminal was cloned in the pET22 plasmid (Novagen). Single point mutation R416A was introduced through the Quick-Change kit (Stratagene ...
-
bioRxiv - Developmental Biology 2023Quote: ... lentiviruses were generated by transfecting 3 x 106 HEK-293T cells in antibiotic-free medium with 6 µg of total DNA in a 1:2:3 ratio of pMD2.G:psPAX2:transfer plasmid using polyethylenimine (PEI) (Sigma-Aldrich). 48 h after transfection ...
-
bioRxiv - Genetics 2023Quote: ... and 1.2 ug of purified plasmid library using 5.8 uL of X-tremeGENE HPTM DNA Transfection Reagent (Millipore Sigma #06366236001). We harvested viral supernatant 24 hours later with 0.45 uM filtration.
-
bioRxiv - Microbiology 2023Quote: ... expressing mammalian expression vector was generated by subcloning CHPV-N gene from PET-3a-CHPV-N plasmid (gift from Dr. Dhrubajyoti Chattopadhayay) in pFLAG-CMV6a (Sigma). Primers F-5’ TTTATA AAGCTT ATGAGTTCTCAAGTATTC3’ and R-5’ TTTATA GGATCCTCATGCAAAGAGTTTCCT3’ containing the Hind III and BamHI sites respectively were used to amplify CHPV-N gene ...
-
bioRxiv - Cell Biology 2023Quote: ... pFastBac-M13-derived plasmids were transformed into DH10BacYFP competent cells and plated on LB-Agar supplemented with 30 μg/ml kanamycin (#K4000, Sigma), 7 μg/ml gentamycin (#G1372 ...
-
bioRxiv - Biochemistry 2024Quote: ... sequences encoding all TE domains were amplified from amber codon-containing expression plasmids (pTMM47-51) and then inserted into pCDF7 (Novagen) vectors with identical construct boundaries (pTMM52-56) ...
-
bioRxiv - Immunology 2024Quote: ... The pool HIP-expressing bacteria was generated by transforming the purified pool plasmid into the Rosetta strain of E coli (Novagen). Four pool HIP-expressing Rosetta were combined to make a ‘super-pool’ ...
-
bioRxiv - Cancer Biology 2021Quote: ... Appropriate secondary antibodies (IgG-Fc Specific-Peroxidase) of mouse or rabbit origin (Sigma-Aldrich) were used.
-
bioRxiv - Genetics 2020Quote: ... and all other germlines were stained with 1:2000 mouse anti-FLAG (Sigma F1804) and 1:250 rabbit anti-SYP-1 (Macqueen et al ...
-
bioRxiv - Biophysics 2020Quote: ... and anti-HA (mouse monoclonal clone HA-7 (cat. no. H3663, Sigma Life Science)) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were probed with mouse anti-anillin monoclonal primary antibody (1:100, Sigma-Aldrich) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Appropriate secondary antibodies (IgG-Fc Specific-Peroxidase) of mouse or rabbit origin (Sigma Aldrich) were used.
-
bioRxiv - Cell Biology 2020Quote: ... rabbit anti-RILPL2 (1:500, Novus) and mouse/rabbit anti-HA (1:1000, Sigma). Anti-sera raised against RILPL2 in rabbit is described in Steger et al (2017 ...
-
bioRxiv - Cell Biology 2020Quote: ... Immunodetection was performed with the following antibodies: anti-Flag mouse (Sigma, #F1804; 1:2,000), anti-GFP rabbit (Abcam ...
-
bioRxiv - Cell Biology 2020Quote: ... Primary antibodies used were: mouse anti-α-tubulin (DM1A) (1:2000; Sigma-Aldrich, T9026), rabbit anti-α-tubulin (1:500 ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Vinculin (Vin-11-5) (1:5000; Sigma-Aldrich, SAB4200729, Vin-11-5), mouse anti-α-tubulin (B-5-1-2 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-acetylated tubulin (6-11B-1; 1:1000 for IF; Cat#6793, Sigma), mouse monoclonal anti-glutamylated tubulin (B3 ...
-
Kinetochore individualization in meiosis I is required for centromeric cohesin removal in meiosis IIbioRxiv - Cell Biology 2020Quote: ... mouse monoclonal anti-α-tubulin (DM1A) coupled to FITC (Sigma-Aldrich, F2168, 1:100) polyclonal rabbit anti-Mps1 (gift from Hongtao Yu ...
-
bioRxiv - Developmental Biology 2020Quote: The following primary antibodies were used: mouse anti-GFP(1:200; Millipore, MAB#3580); goat anti-GFP (1:200 ...
-
bioRxiv - Immunology 2021Quote: ... or a monoclonal mouse anti-tubulin antibody (Sigma-Aldrich, Clone B-5-1-2). Horseradish peroxidase (HRP)-conjugated anti-rabbit (Cell Signaling Technology ...
-
bioRxiv - Genetics 2021Quote: ... antibodies and precipitated proteins were analyzed by western blot using mouse anti-HA (Sigma) or mouse anti-Flag (Sigma) ...
-
bioRxiv - Genetics 2021Quote: ... mice were administered E2 (E8875, Sigma-Aldrich, St. Louis, MO; 100 ng per mouse) as daily injections for 3 days ...
-
bioRxiv - Microbiology 2021Quote: ... Freund’s adjuvant and goat anti-mouse lgG were purchased from Sigma-Aldrich (Missouri, USA).
-
bioRxiv - Molecular Biology 2021Quote: ... and channels were labeled with primary mouse anti-HA (HA-7, Sigma, 1/1000), rabbit anti-V5 (PRB-189P ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were incubated with primary antibodies (mouse anti-human synuclein, Sigma S5566 (clone SYN211) for human alpha-synuclein ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Detection of S was done with mouse monoclonal ANTI-FLAG M2 antibody (Sigma F3165) and Alexa Fluor 680 AffiniPure Goat Anti-Mouse IgG ...