Labshake search
Citations for Millipore Sigma :
7401 - 7450 of 10000+ citations for Mouse FAM117A shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... the α-PheRS or α-PheRSCys mutant cDNAs were cloned with His tags at the N-terminal end into the pET-28a plasmid expression vector (Novagen). Wild-type β-PheRS cDNAs were cloned into the pET LIC (2A-T ...
-
bioRxiv - Biophysics 2021Quote: ... The spectinomycin resistance gene on the pULTRA-CNF plasmid was replaced by the kanamycin resistance gene from pRSF1b (EMD Millipore) for use in TOP10 cells.
-
Mediobasal hypothalamic FKBP51 acts as a molecular switch linking autophagy to whole-body metabolismbioRxiv - Neuroscience 2021Quote: ... A total of 2.5 μg of plasmid DNA or 80 ng of siRNA (siWIPI3, EMU081491 or siWIPI4, EMU007321 or siControl, SIC001 all Sigma) was used per transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were transfected with 1 μg of nucleocytoplasmic transport reporter (NLS-tdTomato-NES) plasmid (received as a gift from Dr. Martin W. Hetzer, Salk Institute) using Novagen Nanojuice Transfection Reagent (Millipore-Sigma). 4 h after transfection ...
-
bioRxiv - Biophysics 2020Quote: ... was PCR amplified from previously described pCDFDuet-1-RUVBL2 plasmid (Lopez-Perrote et al., 2012) and inserted into pET21b vector (Novagen) using the IVA cloning system (Garcia-Nafria et al. ...
-
bioRxiv - Biophysics 2020Quote: ... 293T cells were transfected with 2.5 μg of ΔEnv IN-HIV-1 plasmid (DHIV3-GFP-D116G)11 using 10 μg of polyethylenimine (PEI, branched, MW ∼25,000, Sigma-Aldrich). After 20 h ...
-
bioRxiv - Immunology 2021Quote: PCR was used to amplify EtMIC3 DNA from the pET22b MIC3 plasmid using primers (F: GCTATCGGATCCCAAGCCGTTCCAGAGG, R: CTGCGAGAATTCGCCACTTGGATCTTCCGTT, 0.4 μM final concentration, Sigma Aldrich) that incorporated appropriate restriction enzyme sites (Bam HI and Eco RI ...
-
bioRxiv - Microbiology 2021Quote: ... 105 MA104 cells were transfected with the pCMV-HyPBase (63) and transposon plasmids pPB-cytBirA using a ratio of 1:2.5 with Lipofectamine 3000 (Sigma-Aldrich) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... PCR-positive colonies were grown and the vector was extracted using GenElute Plasmid Miniprep Kit following manufacturer’s protocol (Sigma-Aldrich). The vector was then transformed into expression strain E ...
-
bioRxiv - Biophysics 2021Quote: ... 293T cells were transfected with 2.5 μg of ΔEnv IN- HIV-1 plasmid (DHIV3-GFP-D116G) (31) using 10 μg of polyethylenimine (PEI, branched, MW ~25,000, Sigma-Aldrich). After 20 h ...
-
bioRxiv - Biophysics 2020Quote: ... Cell cultures were transfected with 1mg of plasmid per liter of culture at a density of 2×106/ml using polyethylenimine (Sigma). The supernatants were collected 72 hours later ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmids were transiently transfected to the TMEM16F-KO HEK 293T cells by using X-tremeGENE9 transfection reagent (Millipore-Sigma). Cells grown on poly-L-lysine (PLL ...
-
bioRxiv - Cell Biology 2020Quote: ... mADD1 has 6xHis tag at its N terminus followed by TEV protease recognition site and the plasmid was transformed into Rosetta (DE3) pLysS cells (Novagen). Target protein was expressed in cultures grown in autoinduction media at 18°C overnight 48 ...
-
bioRxiv - Immunology 2022Quote: ... and 11.05 μg of each pCVL-derived gH plasmid were mixed in 1.56mL PBS followed by 39µL of Freestyle Transfection Reagent (Millipore, catalog #72181). The transfection mix was gently agitated ...
-
bioRxiv - Biochemistry 2022Quote: ... codon-optimized for Escherichia coli (E. coli) was cloned into the first multiple cloning site (MCS) of the pRSFDuet plasmid (Novagen), with N-terminal hexahistidine purification (His6 ...
-
bioRxiv - Microbiology 2020Quote: ... The construction of baculovirus transfer vectors encoding hVP3 mutant polypeptides were generated using PCR-based site directed mutagenesis on the pFB/hisVP3 plasmid (Kochan et al. 2003) using synthetic DNA oligonucleotide primers (Sigma) described in Supplementary Table 1 ...
-
bioRxiv - Biophysics 2020Quote: ... the SARS-CoV-2 Mpro gene from strain BetaCoV/Wuhan/WIV04/2019 GenScript (Piscataway, NJ, USA) was inserted into pETGSTSUMO vecror.The plasmid was transformed into Rosetta™(DE3) pLysS Competent Cells (Novagen). A single colony was picked for overnight growth to inoculate 50 mL of LB broth with 50□μg/mL kanamycin and 35 μg/ mL chloramphenicol ...
-
bioRxiv - Microbiology 2021Quote: ... pFPV-TurboFP650 recombinant plasmids were selected on Trypticase Soya Agar (TSA - BioMérieux) containing 100 µg/mL of carbenicillin (Sigma-Aldrich) and clones which showed a purple color were selected for restriction analysis ...
-
bioRxiv - Microbiology 2020Quote: ... The shRNA targeting the HPS-1 gene (TRCN0000292556) as well as the packaging plasmids pCMV-VSV-G and pCMV-dR8.91 were obtained from Sigma Aldrich. The plasmids encoding the shRNA sequences were pooled in equal concentrations and mixed with the packaging plasmids pCMV-VSV-G and pCMV-dR8.91 to generate lentiviral particles ...
-
bioRxiv - Microbiology 2021Quote: ... propagated in LB medium with 25 μg/ml ampicillin and plasmid purifications were performed according to the manufacturers’ instructions (Sigma).
-
bioRxiv - Biochemistry 2020Quote: ... PCNA-12 co-expression plasmids were constructed by inserting non-tagged PCNA-1 into multiple cloning site 1 and PCNA-2 (without and with a His6-tag) into site 2 of pET-DUET-1 plasmid (Novagen).
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were transfected with RCAS plasmids (RCAS-Cre, PDGFB, and PDGFB+IL13Rα) using GeneJuice (Millipore Sigma, Burlington, MA; Cat # 70967), per the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... PC-3 cells were transfected with either the control or Sirt5 CRISPR/Cas9 plasmids according to the manufacturer’s instructions (Sigma-Aldrich). The transfection efficiency was determined by a green fluorescent protein (GFP ...
-
bioRxiv - Molecular Biology 2022Quote: ... MAX Efficiency buffer and 15 µg linearized plasmid DNA was added before loading into an 0.2mm gap electroporation cuvette (Sigma Z706086).
-
bioRxiv - Synthetic Biology 2019Quote: ... To construct the basic expression vector for type IV pilus assembly the T7 promoter in the plasmid vector pET24b (Novagen) was replaced with tac promoter 30 ...
-
bioRxiv - Cell Biology 2019Quote: ... Biosensors were either made in their original plasmid or in form of PCR fusion-product and were sub-cloned in the pTriEx-4neo vector (Novagen) under NcoI and BamH1 site ...
-
bioRxiv - Microbiology 2019Quote: ... and the transposon plasmid pPB-NSP5/Δ3 and pPB-NSP5/ΔT using a ratio of 1:2.5 with Lipofectamine 3000 (Sigma-Aldrich) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... amplicons of 1008 bp were digested with NdeI and XhoI and inserted into the predigested pET28b plasmid (Novagen, Madison, WI). Successful cloning of the gene was confirmed by restriction endonuclease and DNA sequence analyses (data not shown) ...
-
bioRxiv - Biochemistry 2019Quote: ... codon-optimized for Escherichia coli (E. coli) were cloned into the first multiple cloning site (MCS) of the pETDuet plasmid (Novagen), with N-terminal hexahistidine purification (His6 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Cells were transiently transfected with plasmids in 6-well plates and 24 hours post-starvation were incubated with 100μg/ml of cycloheximide (Sigma #4859) for indicated time points ...
-
bioRxiv - Biochemistry 2020Quote: ... which was transformed with the XylE gene in the presence or absence of the chosen mutations and cloned in the (30 µg/ml) kanamycin-resistant pET28-a plasmid (Novagen) modified with a C-terminal 10-histidine tag ...
-
bioRxiv - Plant Biology 2019Quote: ... The gold particles were prepared by precipitating 5 μg of each DNA plasmid construct on to the gold particles with 625mM CaCl2 (Sigma) and 10mM spermidine (Sigma) ...
-
bioRxiv - Biochemistry 2021Quote: ... bacteriovorus HD100 genomic DNA using primers detailed in Table S1 Amplified construct DNA was inserted into a modified pET41c plasmid (Novagen, GST-tag removed and thrombin cleavable 8xHis-tag introduced at C-terminus ...
-
bioRxiv - Microbiology 2020Quote: HEK293 cells were transfected with plasmids encoding different ACE2 orthologs (Table S1) by polyetherimide (PEI) (Sigma, St Louis, MO, USA). After 40 hrs incubation ...
-
bioRxiv - Cancer Biology 2020Quote: ... The pLKO.1-shBeclin1 and control plasmids (TRCN0000299864, TRCN0000299790, and SHC016-Control) were purchased from Sigma (St. Louis, MO, USA). The pLKO.1-shE-cadherin plasmids were obtained from the Functional Genomics Core at MD Anderson ...
-
bioRxiv - Microbiology 2019Quote: ... PfCERLI1HAGlmS parasites were transfected with the an episomal cytosolic GFP expressing plasmid pHGBrHrBl-1/2 and maintenance of this plasmid was selected for using 5 μg/mL blasticidin-S-deaminase HCl (Merck Millipore). Maintenance of the SLI-TGD plasmid was selected for using 20 μM WR99210 ...
-
bioRxiv - Microbiology 2019Quote: ... and the PCR product was purified and cloned in-frame with a His-tag into the IPTG-inducible expression plasmid pET-15b (Novagen) to create construct pET15b-Pnf ...
-
bioRxiv - Microbiology 2021Quote: ... in 6 well plates were transfected with HSIV-vif plasmids using Fugene 6 or X-tremeGENE 9 DNA transfection reagent (Roche/Sigma). At 48 hour post-transfection ...
-
bioRxiv - Microbiology 2021Quote: HepG2 cells were co-transfected with MafF-encoding or control vectors together with the HBV ayw plasmid both with or without 5 µM entecavir (Sigma) as a control ...
-
bioRxiv - Biochemistry 2021Quote: ... Transient transfection of U2OS and HepG2 cells with plasmid DNA was carried out using GeneJuice (Merck Millipore, cat. number 70967) according to manufacturer’s instruction and keeping GeneJuice to DNA ratio of 3:1 (volume in μl ...
-
bioRxiv - Biochemistry 2021Quote: For co-immunoprecipitation HEK293T cells in T75 cm2 flask were transfected with 1μg of each plasmid DNA using GeneJuice transfection reagent (EMD Millipore) as per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: The pOP3MT plasmid containing the sequence of the mature form of SKD3 was transformed into Escherichia coli BL21(DE3) (Millipore-Sigma). Cells were cultured in 2 × 5 ml LB broth with 100 μ g/ml ampicillin for 16 hours at 30 °C with shaking ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmids were transiently transfected to the TMEM16F-KO HEK 293T cells by using X-tremeGENE9 transfection reagent (Millipore-Sigma). Cells grown on poly-L-lysine (PLL ...
-
bioRxiv - Cell Biology 2020Quote: ... used for plasmid construction and propagation were cultured in Luria- Bertani (LB) broth or agar plates containing ampicillin (50 μg/ml, Sigma) as appropriate.
-
bioRxiv - Cancer Biology 2021Quote: ... BC44 cells were plated in a concentration of 150,000 cells/well in 6-well plates and transfected the next day with 2 μg of the designed plasmids and X-tremeGENE HP DNA Transfection Reagent (Sigma) using a 1:1 ratio of μl X-tremeGENE HP DNA Transfection Reagent to μg DNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... 500 ng CRISPR-Cas9 (PX458) plasmid having the right sgRNA insert (Table S1) was transfected along with transfection reagent Lipofectamine 2000 (Sigma) at a 1:3 DNA to reagent ratio ...
-
bioRxiv - Immunology 2020Quote: ... or A3F-HA (500 ng or 100 ng) and titration of pCG-Vif-AU1 expression plasmids (0, 25, 50, 100 and 200 ng) using GeneJuice (Novagen) transfection reagent ...
-
bioRxiv - Genetics 2020Quote: Serial ten-fold dilutions of logarithmic yeast cells were spotted on fresh Synthetic Dextrose (SD)-complete (or SD lacking a specific amino acid to preserve the plasmid) plates with or without different concentrations of Methyl methane sulfonate (MMS)(Sigma) and incubated at 30°C for three days ...
-
bioRxiv - Microbiology 2022Quote: ... coli and inserted between the BamHI and XhoI sites in the multicloning site of the pET21a plasmid (Novagen, Madison, WI). The recombinant protein ...
-
bioRxiv - Immunology 2022Quote: Mammalian expression plasmids containing indicated DNA constructs were transfected into HEK293T cells using the transfection agent polyethylenimine (PEI; Sigma-Aldrich) at 1:1 ratio (w/w DNA:PEI ...