Labshake search
Citations for Millipore Sigma :
701 - 750 of 4532 citations for Human LACC1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... human insulin (Sigma # I0516) was added at a final concentration of 0.01mg/ml ...
-
bioRxiv - Biochemistry 2024Quote: ... human AC16 cells (Millipore) were cultured in DMEM/F12 supplemented with 10% FBS and either 6% D2O (heavy labeled population ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmids were harvested using the GenElute HP plasmid maxiprep kit (Sigma), using 200 ml of culture per plasmid purification column ...
-
bioRxiv - Microbiology 2020Quote: ... plasmid DNA was isolated (GenElute Plasmid Miniprep Kit™, Sigma Aldrich) and further amplified by vector-PCR ...
-
bioRxiv - Synthetic Biology 2019Quote: ... the plasmids were extracted using GenElute Plasmids Miniprep Kit (Sigma-Aldrich) and verified by sequencing ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the plasmids were extracted using GenElute Plasmids Miniprep Kit (Sigma-Aldrich). Each operon constituting the circuits was constructed monocistronically and its sequence was verified before combined into circuits ...
-
bioRxiv - Microbiology 2022Quote: ... plasmids were isolated using a GenElute Plasmid Miniprep Kit (Sigma-Aldrich) and sequenced using standard primers EGFP-C-for (GTCCTGCTGGAGTTCGTG ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Plasmid minipreps were prepared using GeneElute Plasmid MiniPrep Kit (Sigma-Aldrich) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... recombinant insulin human (≥ 98%), somatostatin-14 (≥ 97%, human HPLC grade), and urocortin-3 (≥ 97%, human HPLC grade) were all purchased from Sigma-Aldrich. Taxonomy will only be indicated for insulin ...
-
bioRxiv - Cancer Biology 2021Quote: ... RD cells were transduced with shRNA control lentivirus particles or shMCU lentivirus particles with polybrene (8μg/ml) (Sigma-Aldrich Inc.). Transduced cells were selected with 1μg/ml puromycin (Sigma-Aldrich Inc. ...
-
bioRxiv - Cancer Biology 2021Quote: ... To deplete mouse STK3 expression in HMVP2 cells TRC2 MISSION shRNAs in pLKO.1-puro vector backbone were used (Millipore-Sigma). Lentivirus was generated with psPAX2 and pMD2.G packaging plasmids using with the Polyplus jetPRIME transfection kit in 293T cells ...
-
bioRxiv - Developmental Biology 2021Quote: ... Human fibroblasts were doubly transduced with either shRNA or CRISPR vectors in consecutive days in the presence of 8 µg/ml protamine sulfate (Sigma). Transduced cells were selected by puromycin at 1 μg/ml.
-
bioRxiv - Molecular Biology 2021Quote: Stable RNAi-mediated knockdown of TRMT2A was achieved by infection of HEK293T cells with commercially available Lentiviral particles (MISSION® shRNA Lentviral Transduction Particles NM_182984.2-1574s1c1; Sigma-Aldrich). Cells with stable integration of the shRNA construct were determined by a selection of puromycin-resistant colonies (0.5 μg/ml puromycin ...
-
bioRxiv - Molecular Biology 2021Quote: ... The same procedure was used to generate a control cell line (short shK) expressing a scrambled shRNA (SHC002V; Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2021Quote: For stable knock down of PYCR1, shPYCR1 (shPCYR1 #1: CCGGTGAGAAGAA GCTGTCAGCGTTCTCGAGAACGCTGACAGCTTCTTCTCATTTTTG, shPYCR1 #2: CCGGCACAGTTTCTGC TCTCAGGAACTCGAGTTCCTGAGAGCAGAAACTGTGTTTTTG) and shCTL (Sigma, Mission shRNA) lentivirus was generated in HEK293 cells ...
-
bioRxiv - Cancer Biology 2021Quote: MFSD1kd tumor cells were generated by MISSION lentiviral transduction particles expressing short hairpin RNA (shRNA) from pLKO.1 vector targeting the coding sequence of MFSD1 (Sigma, TRC clone ID TRCN0000338002 and TRCN0000337937 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Stable cell lines were established using gene specific mission shRNAs (Cat# TRCN0000000595, TRCN0000000592, TRCN0000230910) or non-targeting control (Sigma-Aldrich). Cells were plated at 5×105 in a 6-well dish in growth medium containing 8μg/mL polybrene ...
-
bioRxiv - Cancer Biology 2022Quote: ... The same method was used for virus to be used for GSCs (DMEM was changed to NBM).The shRNA construct number TRCN0000152163 from Sigma human TRC shRNA library was used for knockdown studies of human FMOD ...
-
bioRxiv - Cancer Biology 2021Quote: ... The shRNA and packaging vectors (pMD2.G and psPAX2) were transiently co-transfected into 293T cells by polyethylenimine (Sigma, P3143), and the resulted lentivirus particles were harvested and precipitated by PEG8000 ...
-
bioRxiv - Immunology 2022Quote: Stable knockdown of host proteins in THP1 cells was carried out by transduction with lentivectors expressing individual shRNAs (pLKO.1, 400 ng p24Gag (as measured by ELISA) per 1 × 106 cells) in the presence of polybrene (Millipore). Cells were washed and cultured for 5-7 days in the presence of puromycin (2 µg/ml ...
-
bioRxiv - Molecular Biology 2019Quote: ... and expression of shRNAs were monitored under microscope by RFP expression after 96 hours treatment with 2mg/mL Doxycycline (Sigma).
-
bioRxiv - Cancer Biology 2020Quote: ... were infected with lentiviral pLKO.1-puro vectors expressing specific shRNA sequences for 24 h in the presence of polybrene (8μg/ml; Sigma-Aldrich). After further 24 hrs ...
-
bioRxiv - Genetics 2020Quote: Previously validated shRNA-encoding oligos targeting murine Ubr5 and or a scrambled sequence were cloned into pLKO.1-puro (Sigma). shUBR5 and shScrambled-pLKO.1-puro were co-transfected with pCMV-VSV-G and pCMV-dR8.2 dvpr plasmids into HEK 293T cells using TransIT293 reagent (Mirus Bio LLC ...
-
bioRxiv - Cell Biology 2022Quote: ... two shRNA targeting exon 5 and exon 6 were synthesized along with a control shRNA targeting the luciferase gene as a 97-nt ultramer (Sigma) containing 22-mer reverted repeats ...
-
bioRxiv - Cancer Biology 2021Quote: ... shRor2-1 and shRor2-2 hairpin sequences correspond with shRor2-94 and -98 clones from the MISSION pLKO Lentiviral shRNA libraries (Sigma). Wnt pathway reporters (plasmid 7TGC #24304 ...
-
bioRxiv - Cell Biology 2021Quote: WT and SIRT1 KO mESCs with stable Smpdl3b knockdown were generated by infecting WT and SIRT1 KO mESCs with lentivirus containing vector pLKO.1 or constructs expressing shRNAs against Smpdl3b (B11, B12, and C1) (Sigma). WT and SIRT1 KO mESCs with stable overexpression of SMPDL3B were generated with lentivirus carrying vector Plenti-III-ef1α (Abm ...
-
bioRxiv - Cell Biology 2021Quote: ... or control non-target shRNAs were induced to differentiate for 6 days and RNA was extracted with Tri-Reagent (Sigma) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... lentiviral vectors encoding for shRNAs sequences targeting CDA (CCGGCATGAGAGAGTTTGGCACCAACTCGAGTTGGTGCCAAACTCTCTCATGTTTTTG) were cloned into pLKO.1 puromycin vector and obtained from Sigma. Vectors encoding for random shRNA (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... DM cells were infected by shRNA lentivirus twice via spinoculation in the presence of 5 μg/mL polybrene (Sigma-Aldrich). 72 hours post transduction ...
-
bioRxiv - Immunology 2023Quote: The shRNA oligos were designed from the Broad Institute Genetic Perturbation platform and the shRNA clones in pLKO.1 were purchased from Sigma. The three oligo sequences for pLKO.1-shSAMD9L are ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse NAFs were transduced using lentiviruses containing shRNA constructs against Postn with 10 mg/ml polybrene (Sigma, TR-1003-G). shPostn1 (F primer ...
-
bioRxiv - Cell Biology 2024Quote: ... GFP-PMCA4bLA and PMCA4-specific shRNA expressing MCF-7 lines were mixed with cold Matrigel (Corning Matrigel, DLW356231, Sigma-Aldrich) and 15 µl of cell-Matrigel mixtures were added to removable 8-well chambers (80841 ...
-
bioRxiv - Cell Biology 2024Quote: ... The vector control and PTP1B knockdown clones were generated in LCN2.3 by transfecting these cells with an shRNA construct against PTP1B and maintained in 0.5μg/ml puromycin (Sigma Catalog #8833) ETS1 knockdowns were performed as described (Chaudhary et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... A549 shPARP14 as well as shp62 knockdown cells were generated in the lab using lentiviral shRNA constructs TRCN0000290897 and TRCN0000007237 (Sigma). All cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Neuroscience 2024Quote: ... TSC1 or AMPK knockdown in RPE1 cells were achieved by infecting cells with viruses derived from pLKO-1 harboring the shRNAs against TSC1 (TRCN0000010453 and TRCN0000039734, Sigma) or AMPK (TRCN00000196482 and TRCN00000219690 ...
-
bioRxiv - Bioengineering 2023Quote: ... human iPSC-derived cardiomyocytes were suspended in fibrinogen from human plasma (Sigma-Aldrich) at a concentration of 50x106 cells/ml ...
-
bioRxiv - Bioengineering 2023Quote: ... human iPSC-derived cardiomyocytes were suspended in fibrinogen from human plasma (Sigma-Aldrich) at a concentration of 50x106 cells/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... and retinal levels of human Pi and serum levels of human insulin were measured using human Pi and human insulin ELISA kits (EZHPI-15K and EZHI-14K, respectively; Millipore, Darmstadt, Germany) according to the manufacturer’s instructions and as described previously (Isiegas et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmids were purified using a GenElute HP Plasmid MidiPrep Kit (Sigma-Aldrich). To generate plasmids for CRISPR/Cas9 KO cell lines ...
-
bioRxiv - Microbiology 2021Quote: ... plasmid DNA was isolated using GenElute ™ Plasmid Miniprep Kit (Sigma-Aldrich) and sequenced using the M13 primers ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... Plasmid was then extracted by GenElute™ Plasmid Miniprep Kit (Sigma-Aldrich) and verified by DNA sequencing (BMR Genomics ...
-
bioRxiv - Biophysics 2020Quote: ... Plasmids were purified using a GenElute HP Plasmid MidiPrep Kit (Sigma-Aldrich). The tgLAT construct(20 ...
-
bioRxiv - Immunology 2020Quote: ... Plasmids were purified with the GenElute Plasmid DNA Miniprep Kit (Sigma-Aldrich), quantified using the Qubit fluorometer (Thermo Fisher ...
-
bioRxiv - Microbiology 2022Quote: ... The plasmid was isolated using “GenElute™ Plasmid Midiprep” kit (Sigma Aldrich) and digested with SmaI (Thermo Scientific)
-
bioRxiv - Neuroscience 2022Quote: Plasmid DNA was purified with the GenElute HP Plasmid miniprep kit (Sigma) and microinjected in the worm gonad according to a standard protocol (Evans ...
-
bioRxiv - Molecular Biology 2022Quote: ... plasmids were purified using the GenElute HP Plasmid Midiprep Kit (Sigma-Aldrich). All of the L1 expression plasmids contain a retrotransposition-competent L1 (L1.3 ...
-
bioRxiv - Microbiology 2023Quote: ... Afterward the plasmid was isolated using GenElute plasmid miniprep kit (Sigma Aldrich). The recipient strains (AMp07 and WSM419 ...
-
bioRxiv - Cancer Biology 2021Quote: ... SMO-inhibitor resistant Daoy cells with shRNA-mediated knockdown of SUFU had been generated in our lab using the TRCN0000019466 construct (Sigma-Aldrich) [52].
-
bioRxiv - Cancer Biology 2021Quote: ... To deplete mouse STK3 expression in HMVP2 cells TRC2 MISSION shRNAs in pLKO.1-puro vector backbone were used (Millipore-Sigma). Lentivirus was generated with psPAX2 and pMD2.G packaging plasmids using with the Polyplus jetPRIME transfection kit in 293T cells ...
-
bioRxiv - Cell Biology 2020Quote: ... or human NUP153-specific shRNA lentivirus particles overnight at 37°C followed by selection in medium containing Puromycin (Puro, 2 μg/ml) (Sigma-Aldrich) for 48 hr ...